Incidental Mutation 'R6284:Pnpla7'
ID508087
Institutional Source Beutler Lab
Gene Symbol Pnpla7
Ensembl Gene ENSMUSG00000036833
Gene Namepatatin-like phospholipase domain containing 7
SynonymsNRE, E430013P11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location24976033-25054057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25016618 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 664 (D664E)
Ref Sequence ENSEMBL: ENSMUSP00000044078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045295] [ENSMUST00000137913]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045295
AA Change: D664E

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044078
Gene: ENSMUSG00000036833
AA Change: D664E

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
low complexity region 59 66 N/A INTRINSIC
cNMP 170 295 2.06e-12 SMART
low complexity region 439 444 N/A INTRINSIC
cNMP 481 600 1.16e-6 SMART
cNMP 603 716 1.55e-7 SMART
Pfam:Patatin 950 1116 3.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137913
SMART Domains Protein: ENSMUSP00000141577
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 40 N/A INTRINSIC
Pfam:cNMP_binding 162 200 2.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139643
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human patatin-like phospholipases, such as PNPLA7, have been implicated in regulation of adipocyte differentiation and have been induced by metabolic stimuli (Wilson et al., 2006 [PubMed 16799181]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Pnpla7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Pnpla7 APN 2 24976315 critical splice donor site probably null
IGL00765:Pnpla7 APN 2 24980224 missense probably damaging 0.98
IGL01576:Pnpla7 APN 2 25016563 missense probably damaging 1.00
IGL01626:Pnpla7 APN 2 25050893 missense possibly damaging 0.58
IGL01844:Pnpla7 APN 2 25050973 critical splice donor site probably null
IGL02280:Pnpla7 APN 2 25011577 missense probably benign 0.00
IGL02629:Pnpla7 APN 2 25050945 missense probably damaging 1.00
IGL02642:Pnpla7 APN 2 25050276 missense probably benign 0.24
IGL02931:Pnpla7 APN 2 25015229 missense possibly damaging 0.87
IGL03162:Pnpla7 APN 2 25015289 unclassified probably benign
PIT4495001:Pnpla7 UTSW 2 25042139 missense probably damaging 0.99
R0047:Pnpla7 UTSW 2 25011606 missense probably damaging 1.00
R0047:Pnpla7 UTSW 2 25011606 missense probably damaging 1.00
R0064:Pnpla7 UTSW 2 24997227 nonsense probably null
R0064:Pnpla7 UTSW 2 24997227 nonsense probably null
R0309:Pnpla7 UTSW 2 24987195 missense probably damaging 1.00
R0541:Pnpla7 UTSW 2 24995293 missense probably damaging 0.99
R0556:Pnpla7 UTSW 2 25052301 splice site probably null
R0565:Pnpla7 UTSW 2 24980117 splice site probably benign
R0830:Pnpla7 UTSW 2 24997255 missense probably damaging 1.00
R0865:Pnpla7 UTSW 2 24982123 missense probably benign 0.34
R0893:Pnpla7 UTSW 2 24997240 missense probably damaging 1.00
R0969:Pnpla7 UTSW 2 25050953 missense probably damaging 1.00
R1102:Pnpla7 UTSW 2 24996165 missense probably damaging 1.00
R1551:Pnpla7 UTSW 2 25047708 missense probably benign 0.01
R1572:Pnpla7 UTSW 2 25015251 missense possibly damaging 0.69
R1623:Pnpla7 UTSW 2 25052599 missense probably damaging 1.00
R1876:Pnpla7 UTSW 2 25040973 missense possibly damaging 0.91
R1898:Pnpla7 UTSW 2 25053784 unclassified probably benign
R1909:Pnpla7 UTSW 2 24997288 missense possibly damaging 0.75
R1973:Pnpla7 UTSW 2 25016617 missense probably damaging 1.00
R2230:Pnpla7 UTSW 2 25051598 unclassified probably benign
R2381:Pnpla7 UTSW 2 24980758 missense probably damaging 1.00
R2655:Pnpla7 UTSW 2 25052318 missense probably damaging 1.00
R3125:Pnpla7 UTSW 2 25042138 missense probably damaging 1.00
R4223:Pnpla7 UTSW 2 24982114 missense possibly damaging 0.69
R4411:Pnpla7 UTSW 2 25051704 nonsense probably null
R4573:Pnpla7 UTSW 2 25050873 missense probably damaging 0.98
R4674:Pnpla7 UTSW 2 25052317 missense probably damaging 1.00
R4841:Pnpla7 UTSW 2 24980052 missense probably benign 0.05
R4842:Pnpla7 UTSW 2 24980052 missense probably benign 0.05
R4893:Pnpla7 UTSW 2 25053676 nonsense probably null
R4941:Pnpla7 UTSW 2 24997264 unclassified probably null
R5116:Pnpla7 UTSW 2 25021970 missense probably damaging 0.97
R5126:Pnpla7 UTSW 2 24980044 missense possibly damaging 0.83
R5138:Pnpla7 UTSW 2 25041103 missense possibly damaging 0.88
R5169:Pnpla7 UTSW 2 25050309 missense probably benign 0.03
R5188:Pnpla7 UTSW 2 24997300 missense probably benign 0.06
R5288:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5307:Pnpla7 UTSW 2 25021952 missense possibly damaging 0.81
R5339:Pnpla7 UTSW 2 25002937 missense probably benign 0.10
R5384:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5385:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5479:Pnpla7 UTSW 2 25019441 missense possibly damaging 0.90
R5640:Pnpla7 UTSW 2 25003001 missense possibly damaging 0.92
R5662:Pnpla7 UTSW 2 25052384 missense probably damaging 1.00
R5751:Pnpla7 UTSW 2 24981778 missense probably damaging 0.97
R5874:Pnpla7 UTSW 2 25011649 missense probably benign
R6351:Pnpla7 UTSW 2 25011564 missense probably damaging 0.97
R6513:Pnpla7 UTSW 2 25016538 missense possibly damaging 0.62
R7193:Pnpla7 UTSW 2 25051615 missense probably damaging 1.00
R7503:Pnpla7 UTSW 2 24983532 nonsense probably null
R7526:Pnpla7 UTSW 2 24998666 missense possibly damaging 0.52
R7791:Pnpla7 UTSW 2 25052066 missense probably damaging 1.00
Z1177:Pnpla7 UTSW 2 24998759 missense probably null 0.06
Predicted Primers PCR Primer
(F):5'- TATTCACTGGTTACATCCTGGG -3'
(R):5'- GGACCAGAATTGTGGCTTGC -3'

Sequencing Primer
(F):5'- GTGGTCAGCTGTCATGGAGC -3'
(R):5'- TGTGGCTTGCCCAGAAGG -3'
Posted On2018-03-15