Incidental Mutation 'R6284:Erich2'
List |< first << previous [record 23 of 63] next >> last >|
ID508088
Institutional Source Beutler Lab
Gene Symbol Erich2
Ensembl Gene ENSMUSG00000075302
Gene Nameglutamate rich 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location70508819-70540884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70539684 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 402 (I402N)
Ref Sequence ENSEMBL: ENSMUSP00000097619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100041] [ENSMUST00000134607]
Predicted Effect probably damaging
Transcript: ENSMUST00000100041
AA Change: I402N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097619
Gene: ENSMUSG00000075302
AA Change: I402N

DomainStartEndE-ValueType
low complexity region 63 90 N/A INTRINSIC
low complexity region 93 110 N/A INTRINSIC
low complexity region 268 279 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
low complexity region 428 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134607
AA Change: I376N

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122481
Gene: ENSMUSG00000075302
AA Change: I376N

DomainStartEndE-ValueType
low complexity region 63 90 N/A INTRINSIC
low complexity region 93 110 N/A INTRINSIC
low complexity region 242 253 N/A INTRINSIC
low complexity region 321 339 N/A INTRINSIC
low complexity region 402 437 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151851
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Erich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02596:Erich2 APN 2 70512803 intron probably benign
IGL02945:Erich2 APN 2 70534394 missense probably damaging 0.99
IGL03227:Erich2 APN 2 70512770 intron probably benign
IGL03055:Erich2 UTSW 2 70509185 missense possibly damaging 0.83
R0503:Erich2 UTSW 2 70509699 missense probably damaging 0.96
R0503:Erich2 UTSW 2 70540775 missense unknown
R1134:Erich2 UTSW 2 70536191 nonsense probably null
R1496:Erich2 UTSW 2 70512773 intron probably benign
R3689:Erich2 UTSW 2 70540753 missense unknown
R4027:Erich2 UTSW 2 70512790 intron probably benign
R4833:Erich2 UTSW 2 70534292 missense possibly damaging 0.92
R6884:Erich2 UTSW 2 70509161 missense possibly damaging 0.94
R7485:Erich2 UTSW 2 70531765 missense probably damaging 1.00
R7497:Erich2 UTSW 2 70534322 missense probably damaging 1.00
Z1176:Erich2 UTSW 2 70509114 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GGTAGGAAATACAGAGAGCATCATTTC -3'
(R):5'- GACATTCCTTAACATTCCCTGAAGATG -3'

Sequencing Primer
(F):5'- GAAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- CCTTCAGCAATATCTCTTCAATAA -3'
Posted On2018-03-15