Incidental Mutation 'R6284:Cdh26'
ID508091
Institutional Source Beutler Lab
Gene Symbol Cdh26
Ensembl Gene ENSMUSG00000039155
Gene Namecadherin-like 26
SynonymsLOC381409
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location178430531-178487366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 178449884 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 79 (G79R)
Ref Sequence ENSEMBL: ENSMUSP00000104540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042092] [ENSMUST00000108912]
Predicted Effect probably damaging
Transcript: ENSMUST00000042092
AA Change: G79R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048829
Gene: ENSMUSG00000039155
AA Change: G79R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108912
AA Change: G79R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104540
Gene: ENSMUSG00000039155
AA Change: G79R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Meta Mutation Damage Score 0.1892 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cadherin protein family. Cadherins are a family of calcium-dependent adhesion molecules that mediate cell-cell adhesion in all solid tissues and modulate a wide variety of processes, including cell polarization, migration and differentiation. Cadherin domains occur as repeats in the extracellular region and are thought to contribute to the sorting of heterogeneous cell types and the maintenance of orderly structures such as epithelium. This protein is expressed in gastrointestinal epithelial cells and may be upregulated during allergic inflammation. This protein interacts with alpha integrins and may also be involved in leukocyte migration and adhesion. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Cdh26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cdh26 APN 2 178481624 missense possibly damaging 0.86
IGL01341:Cdh26 APN 2 178457447 missense probably damaging 0.99
IGL02636:Cdh26 APN 2 178449962 missense probably damaging 1.00
IGL03144:Cdh26 APN 2 178468174 missense probably damaging 0.99
R0244:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0245:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0466:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0467:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0514:Cdh26 UTSW 2 178466828 critical splice donor site probably null
R0610:Cdh26 UTSW 2 178449898 missense probably damaging 1.00
R0733:Cdh26 UTSW 2 178486931 missense probably damaging 1.00
R1592:Cdh26 UTSW 2 178449891 missense probably damaging 1.00
R2483:Cdh26 UTSW 2 178466589 missense probably damaging 1.00
R3756:Cdh26 UTSW 2 178470001 splice site probably benign
R4617:Cdh26 UTSW 2 178460642 intron probably benign
R4914:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4915:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4917:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4918:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R5086:Cdh26 UTSW 2 178441417 nonsense probably null
R5573:Cdh26 UTSW 2 178466689 missense probably damaging 0.96
R5809:Cdh26 UTSW 2 178460126 nonsense probably null
R5941:Cdh26 UTSW 2 178481650 nonsense probably null
R6341:Cdh26 UTSW 2 178471573 splice site probably null
R6496:Cdh26 UTSW 2 178449861 missense probably damaging 1.00
R7132:Cdh26 UTSW 2 178486762 missense possibly damaging 0.56
R7664:Cdh26 UTSW 2 178470042 missense probably benign 0.02
R7694:Cdh26 UTSW 2 178460103 missense probably damaging 0.96
R7814:Cdh26 UTSW 2 178470035 missense probably damaging 0.98
R8103:Cdh26 UTSW 2 178468213 missense probably damaging 1.00
RF002:Cdh26 UTSW 2 178466631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCTTGGAAGTGTGATGGC -3'
(R):5'- ATGTACAAGCTTCCCAGATCC -3'

Sequencing Primer
(F):5'- CTATTCCTGAAAGATGTCTTGGTTC -3'
(R):5'- GCTTCCCAGATCCCAACAGAGTAAG -3'
Posted On2018-03-15