Incidental Mutation 'R6284:Lyar'
ID 508101
Institutional Source Beutler Lab
Gene Symbol Lyar
Ensembl Gene ENSMUSG00000067367
Gene Name Ly1 antibody reactive clone
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock # R6284 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 38220470-38234306 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38225995 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 77 (W77R)
Ref Sequence ENSEMBL: ENSMUSP00000122486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087514] [ENSMUST00000114106] [ENSMUST00000123207] [ENSMUST00000130721] [ENSMUST00000132190] [ENSMUST00000146401] [ENSMUST00000152066] [ENSMUST00000154975] [ENSMUST00000155300] [ENSMUST00000202506]
AlphaFold Q08288
Predicted Effect probably damaging
Transcript: ENSMUST00000087514
AA Change: W77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084791
Gene: ENSMUSG00000067367
AA Change: W77R

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 1.7e-18 PFAM
low complexity region 138 152 N/A INTRINSIC
coiled coil region 174 216 N/A INTRINSIC
low complexity region 225 247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114106
AA Change: W77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109741
Gene: ENSMUSG00000067367
AA Change: W77R

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 4.3e-18 PFAM
low complexity region 138 152 N/A INTRINSIC
coiled coil region 174 216 N/A INTRINSIC
low complexity region 225 247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123207
AA Change: W77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121204
Gene: ENSMUSG00000067367
AA Change: W77R

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130721
AA Change: W77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122153
Gene: ENSMUSG00000067367
AA Change: W77R

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 2.4e-17 PFAM
low complexity region 138 152 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131492
Predicted Effect probably damaging
Transcript: ENSMUST00000132190
AA Change: W77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121320
Gene: ENSMUSG00000067367
AA Change: W77R

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 2.4e-17 PFAM
low complexity region 138 152 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146401
Predicted Effect probably benign
Transcript: ENSMUST00000152066
Predicted Effect probably benign
Transcript: ENSMUST00000154975
Predicted Effect probably damaging
Transcript: ENSMUST00000155300
AA Change: W77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122486
Gene: ENSMUSG00000067367
AA Change: W77R

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202506
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Lyar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Lyar APN 5 38228047 splice site probably null
IGL01472:Lyar APN 5 38224722 missense possibly damaging 0.72
IGL02603:Lyar APN 5 38234061 missense probably damaging 0.99
veerie UTSW 5 38227858 missense probably benign 0.05
R1980:Lyar UTSW 5 38224709 missense probably damaging 1.00
R2518:Lyar UTSW 5 38227932 missense probably benign 0.23
R4612:Lyar UTSW 5 38224709 missense possibly damaging 0.92
R4798:Lyar UTSW 5 38227886 missense possibly damaging 0.93
R4799:Lyar UTSW 5 38224779 missense probably damaging 1.00
R5973:Lyar UTSW 5 38227946 missense probably damaging 1.00
R5991:Lyar UTSW 5 38227865 missense probably damaging 0.98
R6045:Lyar UTSW 5 38234008 missense probably benign 0.21
R6548:Lyar UTSW 5 38227858 missense probably benign 0.05
R6551:Lyar UTSW 5 38233272 missense probably damaging 1.00
R7051:Lyar UTSW 5 38224680 missense probably damaging 1.00
R7664:Lyar UTSW 5 38230817 missense probably benign 0.02
R7909:Lyar UTSW 5 38224728 missense probably damaging 1.00
R7938:Lyar UTSW 5 38230951 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAGTTAGGCTGTCTGTGCAG -3'
(R):5'- TTAGCAGGAACCCTCAGATATCTTG -3'

Sequencing Primer
(F):5'- CTGTGCAGTTGGCCAGG -3'
(R):5'- GGAACCCTCAGATATCTTGAGAGC -3'
Posted On 2018-03-15