Mutagenetix > Incidental Mutations

Incidental Mutation 'R6284:Dthd1'

508103

Institutional Source

Beutler Lab

Gene Symbol

Dthd1

Ensembl Gene

ENSMUSG00000090326

Gene Name

death domain containing 1

Synonyms

Gm17384

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R6284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62813823-62888308 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62814041 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 69 (E69G)

Ref Sequence

ENSEMBL: ENSMUSP00000131534 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170704]

AlphaFold

A0A571BG01

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170704
AA Change: E69G

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000131534
Gene: ENSMUSG00000090326
AA Change: E69G

Domain	Start	End	E-Value	Type
Pfam:Death	693	778	4.2e-12	PFAM

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a death domain. Death domain-containing proteins function in signaling pathways and formation of signaling complexes, as well as the apoptosis pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	G	T	6: 72,347,454	G16C	probably damaging	Het
Abca7	G	A	10: 80,004,410	V801I	probably benign	Het
Adgrl2	A	T	3: 148,826,507	L1030Q	probably damaging	Het
Akap1	T	C	11: 88,844,568	T423A	possibly damaging	Het
Anpep	T	A	7: 79,825,802	D111V	probably damaging	Het
Atm	T	A	9: 53,445,376		probably null	Het
Atp5a1	T	A	18: 77,778,468	S106T	probably benign	Het
Atp5k	T	C	5: 108,434,059	I20V	probably benign	Het
Atp6v0d2	T	A	4: 19,922,605		probably null	Het
Bclaf1	T	G	10: 20,322,160		probably null	Het
Bod1l	A	G	5: 41,818,787	V1728A	probably benign	Het
Braf	A	G	6: 39,688,282	F51L	possibly damaging	Het
Camsap2	A	G	1: 136,304,437	I140T	possibly damaging	Het
Ccdc24	A	T	4: 117,869,653		probably null	Het
Cdh26	G	C	2: 178,449,884	G79R	probably damaging	Het
Cenpf	A	G	1: 189,652,742	L2447P	probably damaging	Het
Cfap74	T	C	4: 155,451,796	F863L	probably damaging	Het
Clstn2	C	T	9: 97,454,674	G917S	probably benign	Het
Col6a6	A	T	9: 105,727,227		probably null	Het
Cul5	G	A	9: 53,623,735	P596L	probably damaging	Het
Dst	A	T	1: 34,229,085	R2863W	probably damaging	Het
Erich2	T	A	2: 70,539,684	I402N	probably damaging	Het
Fam160a1	G	A	3: 85,672,688	P737S	probably benign	Het
Fam162b	T	C	10: 51,585,502	K155R	probably damaging	Het
Glb1l2	A	T	9: 26,767,448	S466T	probably benign	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gm5724	T	C	6: 141,725,393	D451G	probably damaging	Het
Ikbkap	A	T	4: 56,762,281	I1106K	probably damaging	Het
Kazn	G	A	4: 142,117,197	L402F	probably benign	Het
Kcnj13	A	T	1: 87,386,886	S205T	probably damaging	Het
Lama1	T	A	17: 67,810,096	V2462E	probably damaging	Het
Lce1b	A	C	3: 92,656,104	C41G	unknown	Het
Lyar	T	A	5: 38,225,995	W77R	probably damaging	Het
March11	G	A	15: 26,409,346	R377Q	probably benign	Het
Mis18bp1	A	G	12: 65,138,787	F869L	probably benign	Het
Myom1	T	A	17: 71,022,892	Y6*	probably null	Het
Myzap	T	C	9: 71,558,925	I150V	probably benign	Het
Nop14	C	T	5: 34,641,491		probably null	Het
Oprl1	T	A	2: 181,717,991		probably benign	Het
Pacsin1	T	C	17: 27,708,504	L432P	probably damaging	Het
Peak1	A	G	9: 56,260,296	L116P	probably benign	Het
Plcb2	C	T	2: 118,717,301	V482M	probably benign	Het
Pnliprp1	T	A	19: 58,734,984	I269N	probably damaging	Het
Pnpla7	C	A	2: 25,016,618	D664E	possibly damaging	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Rps6kb2	G	T	19: 4,161,187	T113K	probably benign	Het
Rrp7a	A	T	15: 83,121,860	I63N	probably damaging	Het
Slc29a1	A	G	17: 45,589,921		probably null	Het
Stxbp5	A	C	10: 9,767,179	S1059A	probably benign	Het
Stxbp5	C	A	10: 9,767,187	G1056V	probably damaging	Het
Taldo1	T	A	7: 141,398,583	S149T	possibly damaging	Het
Tlr1	T	C	5: 64,927,099	D45G	possibly damaging	Het
Tnrc6a	T	C	7: 123,171,335	S783P	probably damaging	Het
Trap1	A	G	16: 4,060,809	Y220H	probably benign	Het
Trpc6	A	G	9: 8,643,600	D462G	possibly damaging	Het
Ttc21a	A	G	9: 119,943,962	E235G	probably damaging	Het
Tubb4a	A	G	17: 57,080,833	Y398H	probably damaging	Het
Ube2z	A	G	11: 96,050,407	F303S	probably damaging	Het
Vmn1r211	A	G	13: 22,852,084	S138P	probably damaging	Het
Zfp93	T	A	7: 24,275,629	C346*	probably null	Het
Zfp938	A	T	10: 82,227,566	S52R	possibly damaging	Het
Zp1	A	T	19: 10,916,503	L446Q	probably damaging	Het

Other mutations in Dthd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Boatman	UTSW	5	62818715	missense	probably benign	0.28
Coin	UTSW	5	62842916	missense	probably damaging	0.98
FR4340:Dthd1	UTSW	5	62843026	small insertion	probably benign
FR4342:Dthd1	UTSW	5	62843026	small insertion	probably benign
FR4589:Dthd1	UTSW	5	62843026	frame shift	probably null
FR4976:Dthd1	UTSW	5	62843024	small insertion	probably benign
R0096:Dthd1	UTSW	5	62843040	missense	possibly damaging	0.75
R0096:Dthd1	UTSW	5	62843040	missense	possibly damaging	0.75
R0395:Dthd1	UTSW	5	62814333	missense	possibly damaging	0.71
R0734:Dthd1	UTSW	5	62839410	splice site	probably benign
R0899:Dthd1	UTSW	5	62842928	missense	probably benign	0.01
R0970:Dthd1	UTSW	5	62887981	missense	probably damaging	1.00
R1104:Dthd1	UTSW	5	62821959	missense	probably damaging	1.00
R1518:Dthd1	UTSW	5	62822040	missense	probably damaging	1.00
R1831:Dthd1	UTSW	5	62827229	missense	probably benign	0.02
R2110:Dthd1	UTSW	5	62821908	missense	probably damaging	1.00
R2110:Dthd1	UTSW	5	62842879	missense	probably damaging	0.99
R2112:Dthd1	UTSW	5	62821908	missense	probably damaging	1.00
R2112:Dthd1	UTSW	5	62842879	missense	probably damaging	0.99
R2248:Dthd1	UTSW	5	62849900	missense	probably damaging	0.99
R2311:Dthd1	UTSW	5	62839237	splice site	probably benign
R2937:Dthd1	UTSW	5	62842957	missense	probably benign	0.02
R2938:Dthd1	UTSW	5	62842957	missense	probably benign	0.02
R3835:Dthd1	UTSW	5	62849785	missense	probably damaging	1.00
R3855:Dthd1	UTSW	5	62827129	missense	probably benign	0.21
R3855:Dthd1	UTSW	5	62888023	missense	probably benign	0.00
R4049:Dthd1	UTSW	5	62827165	nonsense	probably null
R4321:Dthd1	UTSW	5	62818690	missense	probably damaging	0.99
R4353:Dthd1	UTSW	5	62842867	missense	probably benign	0.04
R4560:Dthd1	UTSW	5	62827092	missense	probably damaging	1.00
R4613:Dthd1	UTSW	5	62827068	missense	probably damaging	1.00
R4689:Dthd1	UTSW	5	62842912	missense	probably damaging	0.99
R4715:Dthd1	UTSW	5	62888187	missense	probably benign
R4718:Dthd1	UTSW	5	62818793	missense	probably damaging	1.00
R4967:Dthd1	UTSW	5	62888206	missense	probably benign	0.01
R5068:Dthd1	UTSW	5	62818716	missense	probably benign
R5089:Dthd1	UTSW	5	62849905	missense	probably benign
R5355:Dthd1	UTSW	5	62839387	missense	probably damaging	1.00
R5470:Dthd1	UTSW	5	62818766	missense	probably damaging	1.00
R6293:Dthd1	UTSW	5	62842850	missense	probably damaging	0.99
R6484:Dthd1	UTSW	5	62814332	missense	probably benign	0.34
R6516:Dthd1	UTSW	5	62839264	missense	probably benign	0.16
R6741:Dthd1	UTSW	5	62842946	missense	probably damaging	1.00
R6810:Dthd1	UTSW	5	62814329	missense	probably benign	0.01
R7565:Dthd1	UTSW	5	62843092	missense	probably damaging	1.00
R7595:Dthd1	UTSW	5	62818715	missense	probably benign	0.28
R7947:Dthd1	UTSW	5	62814310	missense	possibly damaging	0.90
R8131:Dthd1	UTSW	5	62842916	missense	probably damaging	0.98
R8356:Dthd1	UTSW	5	62849738	missense	probably damaging	1.00
R8829:Dthd1	UTSW	5	62814265	missense	probably benign	0.01
R8832:Dthd1	UTSW	5	62814265	missense	probably benign	0.01
R8945:Dthd1	UTSW	5	62849753	missense	probably benign	0.02
R9046:Dthd1	UTSW	5	62827260	missense	possibly damaging	0.87
R9180:Dthd1	UTSW	5	62888067	missense	probably benign	0.02
R9390:Dthd1	UTSW	5	62818561	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TGGGGAATACTGCTATGCTTC -3'
(R):5'- GAGACATCCCATGCTGTTGG -3'

Sequencing Primer
(F):5'- GGGGAATACTGCTATGCTTCTAAAG -3'
(R):5'- GTTGTCTGGATTGCATCATGAATATC -3'

Posted On

2018-03-15