Incidental Mutation 'R6284:Tlr1'
ID508104
Institutional Source Beutler Lab
Gene Symbol Tlr1
Ensembl Gene ENSMUSG00000044827
Gene Nametoll-like receptor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location64924679-64933563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64927099 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 45 (D45G)
Ref Sequence ENSEMBL: ENSMUSP00000142500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059349] [ENSMUST00000197315]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059349
AA Change: D45G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060793
Gene: ENSMUSG00000044827
AA Change: D45G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LRR 71 94 5.72e0 SMART
LRR 116 140 3.27e2 SMART
low complexity region 240 256 N/A INTRINSIC
LRR 374 397 9.75e0 SMART
LRR 400 423 4.98e1 SMART
low complexity region 427 438 N/A INTRINSIC
LRR 448 469 6.23e1 SMART
LRR 470 494 4.57e0 SMART
LRRCT 527 581 2.5e-11 SMART
transmembrane domain 583 605 N/A INTRINSIC
TIR 639 782 4.03e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197315
AA Change: D45G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142500
Gene: ENSMUSG00000044827
AA Change: D45G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LRR 71 94 5.72e0 SMART
Pfam:LRR_1 97 114 2.3e-2 PFAM
LRR 116 140 3.27e2 SMART
low complexity region 240 256 N/A INTRINSIC
LRR 374 397 9.75e0 SMART
LRR 400 423 4.98e1 SMART
low complexity region 427 438 N/A INTRINSIC
LRR 448 469 6.23e1 SMART
LRR 470 494 4.57e0 SMART
LRRCT 527 581 2.5e-11 SMART
transmembrane domain 583 605 N/A INTRINSIC
TIR 639 782 4.03e-41 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display decreased macrophage peptoglycan-stimulated IL-6 production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Tlr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tlr1 APN 5 64926434 missense probably benign 0.01
IGL01324:Tlr1 APN 5 64925179 missense probably damaging 1.00
IGL01564:Tlr1 APN 5 64925846 missense probably damaging 1.00
IGL01663:Tlr1 APN 5 64925073 missense possibly damaging 0.48
IGL01689:Tlr1 APN 5 64925779 missense probably damaging 0.97
IGL01749:Tlr1 APN 5 64925947 nonsense probably null
IGL01751:Tlr1 APN 5 64925947 nonsense probably null
IGL01769:Tlr1 APN 5 64925947 nonsense probably null
IGL01899:Tlr1 APN 5 64927016 missense probably damaging 0.97
IGL02197:Tlr1 APN 5 64926454 missense probably damaging 1.00
IGL02295:Tlr1 APN 5 64925947 nonsense probably null
IGL02308:Tlr1 APN 5 64925947 nonsense probably null
IGL02309:Tlr1 APN 5 64925947 nonsense probably null
IGL02311:Tlr1 APN 5 64925947 nonsense probably null
IGL02591:Tlr1 APN 5 64926716 missense probably damaging 1.00
IGL02739:Tlr1 APN 5 64927126 missense probably benign 0.41
IGL03206:Tlr1 APN 5 64925057 missense probably damaging 0.99
IGL03055:Tlr1 UTSW 5 64926596 missense probably benign 0.05
R0315:Tlr1 UTSW 5 64926928 missense probably damaging 0.99
R0317:Tlr1 UTSW 5 64925967 nonsense probably null
R0511:Tlr1 UTSW 5 64926620 missense probably damaging 0.98
R1539:Tlr1 UTSW 5 64926976 missense probably damaging 1.00
R1552:Tlr1 UTSW 5 64926860 missense probably damaging 1.00
R1835:Tlr1 UTSW 5 64925700 missense probably benign 0.01
R1933:Tlr1 UTSW 5 64925438 missense possibly damaging 0.94
R1956:Tlr1 UTSW 5 64925177 missense probably damaging 1.00
R2099:Tlr1 UTSW 5 64925068 missense probably damaging 1.00
R2507:Tlr1 UTSW 5 64925296 missense probably damaging 1.00
R2508:Tlr1 UTSW 5 64925296 missense probably damaging 1.00
R2937:Tlr1 UTSW 5 64925908 missense probably damaging 0.96
R2938:Tlr1 UTSW 5 64925908 missense probably damaging 0.96
R3033:Tlr1 UTSW 5 64925569 missense probably damaging 1.00
R4164:Tlr1 UTSW 5 64927202 missense possibly damaging 0.47
R4226:Tlr1 UTSW 5 64925717 missense probably damaging 0.96
R4366:Tlr1 UTSW 5 64925837 missense probably benign 0.00
R5009:Tlr1 UTSW 5 64926224 missense probably damaging 1.00
R5029:Tlr1 UTSW 5 64925681 missense probably damaging 0.97
R5069:Tlr1 UTSW 5 64926400 missense probably benign 0.01
R5186:Tlr1 UTSW 5 64925221 missense probably damaging 1.00
R5336:Tlr1 UTSW 5 64925802 missense probably damaging 1.00
R5500:Tlr1 UTSW 5 64927098 missense probably benign 0.08
R5503:Tlr1 UTSW 5 64926292 missense probably damaging 0.99
R5577:Tlr1 UTSW 5 64926085 missense possibly damaging 0.94
R6141:Tlr1 UTSW 5 64925213 missense possibly damaging 0.92
R6210:Tlr1 UTSW 5 64925286 missense probably damaging 1.00
R6238:Tlr1 UTSW 5 64927129 missense possibly damaging 0.86
R6311:Tlr1 UTSW 5 64926845 missense probably damaging 0.99
R7021:Tlr1 UTSW 5 64925713 missense possibly damaging 0.75
R7140:Tlr1 UTSW 5 64925678 missense probably benign 0.01
R7234:Tlr1 UTSW 5 64926724 missense probably damaging 0.96
R7278:Tlr1 UTSW 5 64926772 missense probably benign 0.03
R7378:Tlr1 UTSW 5 64925228 missense not run
R7652:Tlr1 UTSW 5 64926787 nonsense probably null
R7781:Tlr1 UTSW 5 64926736 missense possibly damaging 0.94
R7783:Tlr1 UTSW 5 64924921 missense probably damaging 1.00
R7851:Tlr1 UTSW 5 64924964 missense possibly damaging 0.58
R7934:Tlr1 UTSW 5 64924964 missense possibly damaging 0.58
X0067:Tlr1 UTSW 5 64926575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGTGGCACAAGATCACC -3'
(R):5'- CATGTGGCAATGCTCTGAAG -3'

Sequencing Primer
(F):5'- GCTCATTGTGGGACAAATCC -3'
(R):5'- CTCTGAAGAATAGCAGGGACCTC -3'
Posted On2018-03-15