Mutagenetix > Incidental Mutations

Incidental Mutation 'R6284:Braf'

508106

Institutional Source

Beutler Lab

Gene Symbol

Braf

Ensembl Gene

ENSMUSG00000002413

Gene Name

Braf transforming gene

Synonyms

Braf-2, D6Ertd631e, 9930012E13Rik, Braf2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

39603237-39725463 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 39688282 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 51 (F51L)

Ref Sequence

ENSEMBL: ENSMUSP00000099036 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002487] [ENSMUST00000101497]

AlphaFold

P28028

Predicted Effect

probably benign
Transcript: ENSMUST00000002487
AA Change: F85L

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000002487
Gene: ENSMUSG00000002413
AA Change: F85L

Domain	Start	End	E-Value	Type
low complexity region	5	30	N/A	INTRINSIC
low complexity region	46	56	N/A	INTRINSIC
coiled coil region	94	121	N/A	INTRINSIC
RBD	139	211	1.04e-33	SMART
C1	219	264	1.05e-13	SMART
low complexity region	297	311	N/A	INTRINSIC
low complexity region	316	326	N/A	INTRINSIC
low complexity region	459	474	N/A	INTRINSIC
Pfam:Pkinase_Tyr	494	751	9.6e-65	PFAM
Pfam:Pkinase	494	753	5.1e-60	PFAM
Pfam:Kinase-like	573	741	3e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101497
AA Change: F51L

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099036
Gene: ENSMUSG00000002413
AA Change: F51L

Domain	Start	End	E-Value	Type
low complexity region	12	22	N/A	INTRINSIC
coiled coil region	60	88	N/A	INTRINSIC
low complexity region	93	120	N/A	INTRINSIC
RBD	138	210	1.04e-33	SMART
C1	218	263	1.05e-13	SMART
low complexity region	296	310	N/A	INTRINSIC
low complexity region	315	325	N/A	INTRINSIC
low complexity region	406	421	N/A	INTRINSIC
Pfam:Pkinase	441	698	8.2e-62	PFAM
Pfam:Pkinase_Tyr	441	698	1.5e-65	PFAM
Pfam:Kinase-like	523	688	3.2e-11	PFAM

Meta Mutation Damage Score

0.1299

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. This protein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in this gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in this gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die during organogenesis, are smaller, have enlarged blood vessels, hemorrhaging, poor circulation, slow heartbeat and abnormal endothelial cell development. Mice homozygous for a targeted allele activated in neurons exhibit impaired neuronal differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	G	T	6: 72,347,454	G16C	probably damaging	Het
Abca7	G	A	10: 80,004,410	V801I	probably benign	Het
Adgrl2	A	T	3: 148,826,507	L1030Q	probably damaging	Het
Akap1	T	C	11: 88,844,568	T423A	possibly damaging	Het
Anpep	T	A	7: 79,825,802	D111V	probably damaging	Het
Atm	T	A	9: 53,445,376		probably null	Het
Atp5a1	T	A	18: 77,778,468	S106T	probably benign	Het
Atp5k	T	C	5: 108,434,059	I20V	probably benign	Het
Atp6v0d2	T	A	4: 19,922,605		probably null	Het
Bclaf1	T	G	10: 20,322,160		probably null	Het
Bod1l	A	G	5: 41,818,787	V1728A	probably benign	Het
Camsap2	A	G	1: 136,304,437	I140T	possibly damaging	Het
Ccdc24	A	T	4: 117,869,653		probably null	Het
Cdh26	G	C	2: 178,449,884	G79R	probably damaging	Het
Cenpf	A	G	1: 189,652,742	L2447P	probably damaging	Het
Cfap74	T	C	4: 155,451,796	F863L	probably damaging	Het
Clstn2	C	T	9: 97,454,674	G917S	probably benign	Het
Col6a6	A	T	9: 105,727,227		probably null	Het
Cul5	G	A	9: 53,623,735	P596L	probably damaging	Het
Dst	A	T	1: 34,229,085	R2863W	probably damaging	Het
Dthd1	A	G	5: 62,814,041	E69G	possibly damaging	Het
Erich2	T	A	2: 70,539,684	I402N	probably damaging	Het
Fam160a1	G	A	3: 85,672,688	P737S	probably benign	Het
Fam162b	T	C	10: 51,585,502	K155R	probably damaging	Het
Glb1l2	A	T	9: 26,767,448	S466T	probably benign	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gm5724	T	C	6: 141,725,393	D451G	probably damaging	Het
Ikbkap	A	T	4: 56,762,281	I1106K	probably damaging	Het
Kazn	G	A	4: 142,117,197	L402F	probably benign	Het
Kcnj13	A	T	1: 87,386,886	S205T	probably damaging	Het
Lama1	T	A	17: 67,810,096	V2462E	probably damaging	Het
Lce1b	A	C	3: 92,656,104	C41G	unknown	Het
Lyar	T	A	5: 38,225,995	W77R	probably damaging	Het
March11	G	A	15: 26,409,346	R377Q	probably benign	Het
Mis18bp1	A	G	12: 65,138,787	F869L	probably benign	Het
Myom1	T	A	17: 71,022,892	Y6*	probably null	Het
Myzap	T	C	9: 71,558,925	I150V	probably benign	Het
Nop14	C	T	5: 34,641,491		probably null	Het
Oprl1	T	A	2: 181,717,991		probably benign	Het
Pacsin1	T	C	17: 27,708,504	L432P	probably damaging	Het
Peak1	A	G	9: 56,260,296	L116P	probably benign	Het
Plcb2	C	T	2: 118,717,301	V482M	probably benign	Het
Pnliprp1	T	A	19: 58,734,984	I269N	probably damaging	Het
Pnpla7	C	A	2: 25,016,618	D664E	possibly damaging	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Rps6kb2	G	T	19: 4,161,187	T113K	probably benign	Het
Rrp7a	A	T	15: 83,121,860	I63N	probably damaging	Het
Slc29a1	A	G	17: 45,589,921		probably null	Het
Stxbp5	A	C	10: 9,767,179	S1059A	probably benign	Het
Stxbp5	C	A	10: 9,767,187	G1056V	probably damaging	Het
Taldo1	T	A	7: 141,398,583	S149T	possibly damaging	Het
Tlr1	T	C	5: 64,927,099	D45G	possibly damaging	Het
Tnrc6a	T	C	7: 123,171,335	S783P	probably damaging	Het
Trap1	A	G	16: 4,060,809	Y220H	probably benign	Het
Trpc6	A	G	9: 8,643,600	D462G	possibly damaging	Het
Ttc21a	A	G	9: 119,943,962	E235G	probably damaging	Het
Tubb4a	A	G	17: 57,080,833	Y398H	probably damaging	Het
Ube2z	A	G	11: 96,050,407	F303S	probably damaging	Het
Vmn1r211	A	G	13: 22,852,084	S138P	probably damaging	Het
Zfp93	T	A	7: 24,275,629	C346*	probably null	Het
Zfp938	A	T	10: 82,227,566	S52R	possibly damaging	Het
Zp1	A	T	19: 10,916,503	L446Q	probably damaging	Het

Other mutations in Braf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Braf	APN	6	39660999	splice site	probably null
IGL01616:Braf	APN	6	39651652	missense	probably damaging	1.00
IGL01621:Braf	APN	6	39646853	intron	probably benign
IGL01825:Braf	APN	6	39639590	missense	probably damaging	0.99
IGL02435:Braf	APN	6	39646766	missense	probably benign	0.00
IGL02629:Braf	APN	6	39688299	missense	possibly damaging	0.83
IGL02751:Braf	APN	6	39660867	splice site	probably benign
IGL02829:Braf	APN	6	39627728	missense	possibly damaging	0.62
R0041:Braf	UTSW	6	39640479	missense	probably damaging	1.00
R0041:Braf	UTSW	6	39640479	missense	probably damaging	1.00
R0497:Braf	UTSW	6	39640549	splice site	probably benign
R0512:Braf	UTSW	6	39664989	splice site	probably benign
R0604:Braf	UTSW	6	39623697	missense	probably damaging	1.00
R0726:Braf	UTSW	6	39662148	missense	possibly damaging	0.90
R1468:Braf	UTSW	6	39665083	missense	probably damaging	1.00
R1468:Braf	UTSW	6	39665083	missense	probably damaging	1.00
R1616:Braf	UTSW	6	39643133	missense	probably benign	0.35
R2160:Braf	UTSW	6	39662073	missense	probably damaging	1.00
R3722:Braf	UTSW	6	39623676	missense	probably damaging	1.00
R4407:Braf	UTSW	6	39615720	missense	probably damaging	1.00
R4540:Braf	UTSW	6	39644333	missense	probably damaging	1.00
R5026:Braf	UTSW	6	39688287	missense	probably benign	0.22
R5478:Braf	UTSW	6	39677574	missense	possibly damaging	0.94
R6993:Braf	UTSW	6	39643163	missense	probably damaging	1.00
R7251:Braf	UTSW	6	39677570	critical splice donor site	probably null
R7385:Braf	UTSW	6	39665108	critical splice acceptor site	probably null
R7483:Braf	UTSW	6	39627838	missense	possibly damaging	0.86
R7511:Braf	UTSW	6	39688253	missense	probably damaging	0.99
R7660:Braf	UTSW	6	39623641	missense	possibly damaging	0.48
R8323:Braf	UTSW	6	39643124	missense	possibly damaging	0.83
R8527:Braf	UTSW	6	39627759	missense	probably benign	0.37
R8542:Braf	UTSW	6	39627759	missense	probably benign	0.37
R8993:Braf	UTSW	6	39662151	missense	probably damaging	0.99
Z1088:Braf	UTSW	6	39662026	missense	probably damaging	1.00
Z1176:Braf	UTSW	6	39643182	missense	probably damaging	1.00
Z1186:Braf	UTSW	6	39725253	missense	unknown
Z1186:Braf	UTSW	6	39725255	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GAGACATTCCTCTCAGTTTTGAC -3'
(R):5'- AATTGTCTAAAGCCCCGAGAAC -3'

Sequencing Primer
(F):5'- CAGATTGCAACAAGTGAATGAAAAC -3'
(R):5'- CCGAGAACACTGGCAGTTACTG -3'

Posted On

2018-03-15