Incidental Mutation 'R6284:Gm5724'
List |< first << previous [record 28 of 63] next >> last >|
ID508108
Institutional Source Beutler Lab
Gene Symbol Gm5724
Ensembl Gene ENSMUSG00000084927
Gene Namepredicted gene 5724
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location141708118-141773810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141725393 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 451 (D451G)
Ref Sequence ENSEMBL: ENSMUSP00000117177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148411]
Predicted Effect probably damaging
Transcript: ENSMUST00000148411
AA Change: D451G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117177
Gene: ENSMUSG00000084927
AA Change: D451G

DomainStartEndE-ValueType
Pfam:MFS_1 22 405 3.4e-26 PFAM
KAZAL 438 484 1.71e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Gm5724
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Gm5724 APN 6 141754429 missense probably benign 0.14
IGL01347:Gm5724 APN 6 141754466 nonsense probably null
IGL01539:Gm5724 APN 6 141727607 missense possibly damaging 0.88
IGL01613:Gm5724 APN 6 141713214 missense possibly damaging 0.67
IGL02060:Gm5724 APN 6 141754408 missense probably benign 0.00
IGL02063:Gm5724 APN 6 141738889 missense probably benign 0.01
IGL02126:Gm5724 APN 6 141739013 missense probably benign 0.29
IGL02214:Gm5724 APN 6 141723185 missense possibly damaging 0.50
IGL02630:Gm5724 APN 6 141723110 missense probably damaging 1.00
R0966:Gm5724 UTSW 6 141727573 missense probably benign 0.00
R1082:Gm5724 UTSW 6 141712133 missense probably damaging 1.00
R1433:Gm5724 UTSW 6 141765703 missense probably benign 0.00
R1571:Gm5724 UTSW 6 141754409 nonsense probably null
R1765:Gm5724 UTSW 6 141754358 splice site probably benign
R2055:Gm5724 UTSW 6 141725455 missense probably benign 0.33
R2174:Gm5724 UTSW 6 141727593 nonsense probably null
R2495:Gm5724 UTSW 6 141765777 missense probably benign 0.02
R2857:Gm5724 UTSW 6 141744538 missense probably benign 0.35
R3551:Gm5724 UTSW 6 141708596 missense probably benign 0.20
R3824:Gm5724 UTSW 6 141754374 missense possibly damaging 0.50
R3912:Gm5724 UTSW 6 141727636 missense probably damaging 0.97
R3942:Gm5724 UTSW 6 141727714 missense probably damaging 0.98
R4161:Gm5724 UTSW 6 141708596 missense probably benign 0.20
R4168:Gm5724 UTSW 6 141738947 missense probably benign 0.03
R4395:Gm5724 UTSW 6 141712118 missense probably benign 0.02
R4720:Gm5724 UTSW 6 141723222 missense probably damaging 1.00
R4732:Gm5724 UTSW 6 141723179 missense probably benign 0.01
R4733:Gm5724 UTSW 6 141723179 missense probably benign 0.01
R4794:Gm5724 UTSW 6 141767562 missense probably benign 0.11
R5062:Gm5724 UTSW 6 141767454 missense possibly damaging 0.46
R5389:Gm5724 UTSW 6 141740467 missense probably benign 0.12
R5419:Gm5724 UTSW 6 141736100 splice site probably null
R5423:Gm5724 UTSW 6 141744462 missense probably damaging 1.00
R5704:Gm5724 UTSW 6 141713254 missense probably benign 0.00
R5973:Gm5724 UTSW 6 141754456 missense probably benign 0.01
R6041:Gm5724 UTSW 6 141739038 missense probably benign 0.11
R6395:Gm5724 UTSW 6 141723092 splice site probably null
R6993:Gm5724 UTSW 6 141765742 missense possibly damaging 0.94
R7149:Gm5724 UTSW 6 141744452 missense probably damaging 1.00
R7159:Gm5724 UTSW 6 141773778 start codon destroyed probably damaging 1.00
R7627:Gm5724 UTSW 6 141744545 missense probably damaging 1.00
R7784:Gm5724 UTSW 6 141713193 critical splice donor site probably null
R7873:Gm5724 UTSW 6 141727722 missense probably benign 0.44
X0020:Gm5724 UTSW 6 141754365 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGAGCACTGTAACTCATATATTG -3'
(R):5'- CCTTGGAATGTTTACATGTGCATG -3'

Sequencing Primer
(F):5'- CTAATCTAATTTAGGCAAGGACTCC -3'
(R):5'- CATGTGCATGCAAGATGAAGG -3'
Posted On2018-03-15