Mutagenetix > Incidental Mutations

Incidental Mutation 'R6284:Anpep'

508110

Institutional Source

Beutler Lab

Gene Symbol

Anpep

Ensembl Gene

ENSMUSG00000039062

Gene Name

alanyl (membrane) aminopeptidase

Synonyms

aminopeptidase N, Cd13, Apn

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79821803-79861059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79825802 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 111 (D111V)

Ref Sequence

ENSEMBL: ENSMUSP00000145682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502]

AlphaFold

P97449

Predicted Effect

probably damaging
Transcript: ENSMUST00000049004
AA Change: D857V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: D857V

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	6.3e-142	PFAM
Pfam:Peptidase_MA_2	355	502	1.4e-21	PFAM
Pfam:ERAP1_C	618	944	2.9e-45	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107392
AA Change: D857V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: D857V

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	2.5e-139	PFAM
Pfam:ERAP1_C	618	943	2e-73	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000205502
AA Change: D111V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206387

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206682

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	G	T	6: 72,347,454	G16C	probably damaging	Het
Abca7	G	A	10: 80,004,410	V801I	probably benign	Het
Adgrl2	A	T	3: 148,826,507	L1030Q	probably damaging	Het
Akap1	T	C	11: 88,844,568	T423A	possibly damaging	Het
Atm	T	A	9: 53,445,376		probably null	Het
Atp5a1	T	A	18: 77,778,468	S106T	probably benign	Het
Atp5k	T	C	5: 108,434,059	I20V	probably benign	Het
Atp6v0d2	T	A	4: 19,922,605		probably null	Het
Bclaf1	T	G	10: 20,322,160		probably null	Het
Bod1l	A	G	5: 41,818,787	V1728A	probably benign	Het
Braf	A	G	6: 39,688,282	F51L	possibly damaging	Het
Camsap2	A	G	1: 136,304,437	I140T	possibly damaging	Het
Ccdc24	A	T	4: 117,869,653		probably null	Het
Cdh26	G	C	2: 178,449,884	G79R	probably damaging	Het
Cenpf	A	G	1: 189,652,742	L2447P	probably damaging	Het
Cfap74	T	C	4: 155,451,796	F863L	probably damaging	Het
Clstn2	C	T	9: 97,454,674	G917S	probably benign	Het
Col6a6	A	T	9: 105,727,227		probably null	Het
Cul5	G	A	9: 53,623,735	P596L	probably damaging	Het
Dst	A	T	1: 34,229,085	R2863W	probably damaging	Het
Dthd1	A	G	5: 62,814,041	E69G	possibly damaging	Het
Erich2	T	A	2: 70,539,684	I402N	probably damaging	Het
Fam160a1	G	A	3: 85,672,688	P737S	probably benign	Het
Fam162b	T	C	10: 51,585,502	K155R	probably damaging	Het
Glb1l2	A	T	9: 26,767,448	S466T	probably benign	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gm5724	T	C	6: 141,725,393	D451G	probably damaging	Het
Ikbkap	A	T	4: 56,762,281	I1106K	probably damaging	Het
Kazn	G	A	4: 142,117,197	L402F	probably benign	Het
Kcnj13	A	T	1: 87,386,886	S205T	probably damaging	Het
Lama1	T	A	17: 67,810,096	V2462E	probably damaging	Het
Lce1b	A	C	3: 92,656,104	C41G	unknown	Het
Lyar	T	A	5: 38,225,995	W77R	probably damaging	Het
March11	G	A	15: 26,409,346	R377Q	probably benign	Het
Mis18bp1	A	G	12: 65,138,787	F869L	probably benign	Het
Myom1	T	A	17: 71,022,892	Y6*	probably null	Het
Myzap	T	C	9: 71,558,925	I150V	probably benign	Het
Nop14	C	T	5: 34,641,491		probably null	Het
Oprl1	T	A	2: 181,717,991		probably benign	Het
Pacsin1	T	C	17: 27,708,504	L432P	probably damaging	Het
Peak1	A	G	9: 56,260,296	L116P	probably benign	Het
Plcb2	C	T	2: 118,717,301	V482M	probably benign	Het
Pnliprp1	T	A	19: 58,734,984	I269N	probably damaging	Het
Pnpla7	C	A	2: 25,016,618	D664E	possibly damaging	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Rps6kb2	G	T	19: 4,161,187	T113K	probably benign	Het
Rrp7a	A	T	15: 83,121,860	I63N	probably damaging	Het
Slc29a1	A	G	17: 45,589,921		probably null	Het
Stxbp5	A	C	10: 9,767,179	S1059A	probably benign	Het
Stxbp5	C	A	10: 9,767,187	G1056V	probably damaging	Het
Taldo1	T	A	7: 141,398,583	S149T	possibly damaging	Het
Tlr1	T	C	5: 64,927,099	D45G	possibly damaging	Het
Tnrc6a	T	C	7: 123,171,335	S783P	probably damaging	Het
Trap1	A	G	16: 4,060,809	Y220H	probably benign	Het
Trpc6	A	G	9: 8,643,600	D462G	possibly damaging	Het
Ttc21a	A	G	9: 119,943,962	E235G	probably damaging	Het
Tubb4a	A	G	17: 57,080,833	Y398H	probably damaging	Het
Ube2z	A	G	11: 96,050,407	F303S	probably damaging	Het
Vmn1r211	A	G	13: 22,852,084	S138P	probably damaging	Het
Zfp93	T	A	7: 24,275,629	C346*	probably null	Het
Zfp938	A	T	10: 82,227,566	S52R	possibly damaging	Het
Zp1	A	T	19: 10,916,503	L446Q	probably damaging	Het

Other mutations in Anpep

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Anpep	APN	7	79825736	missense	possibly damaging	0.64
IGL00089:Anpep	APN	7	79841986	missense	probably damaging	1.00
IGL00767:Anpep	APN	7	79840890	missense	probably benign	0.00
IGL00901:Anpep	APN	7	79839423	missense	probably benign
IGL01919:Anpep	APN	7	79825350	missense	possibly damaging	0.77
IGL02049:Anpep	APN	7	79835181	missense	probably damaging	0.97
IGL02195:Anpep	APN	7	79826685	missense	probably damaging	1.00
IGL02210:Anpep	APN	7	79826904	missense	probably benign	0.00
IGL02584:Anpep	APN	7	79825393	splice site	probably benign
IGL02677:Anpep	APN	7	79838730	missense	probably damaging	1.00
IGL03073:Anpep	APN	7	79838955	missense	probably damaging	1.00
IGL03100:Anpep	APN	7	79836361	missense	probably benign	0.01
PIT4696001:Anpep	UTSW	7	79839464	missense	possibly damaging	0.85
R0329:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0330:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0619:Anpep	UTSW	7	79841009	missense	probably benign
R0691:Anpep	UTSW	7	79839299	missense	probably damaging	0.98
R1004:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1005:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1274:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1288:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1289:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1532:Anpep	UTSW	7	79826948	nonsense	probably null
R1540:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1618:Anpep	UTSW	7	79835417	missense	probably benign	0.00
R1627:Anpep	UTSW	7	79842011	missense	probably benign
R1693:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1717:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1745:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1746:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1748:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1809:Anpep	UTSW	7	79841823	missense	probably benign	0.01
R1901:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1902:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1903:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1985:Anpep	UTSW	7	79840857	splice site	probably null
R2379:Anpep	UTSW	7	79841218	missense	probably benign	0.28
R2508:Anpep	UTSW	7	79838291	missense	possibly damaging	0.80
R3110:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3112:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3898:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3899:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3900:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R4211:Anpep	UTSW	7	79840996	nonsense	probably null
R4701:Anpep	UTSW	7	79839465	missense	probably benign	0.16
R4716:Anpep	UTSW	7	79826632	missense	probably benign	0.00
R5020:Anpep	UTSW	7	79833727	missense	probably benign
R5042:Anpep	UTSW	7	79839469	missense	probably benign	0.00
R5084:Anpep	UTSW	7	79826870	critical splice donor site	probably null
R5319:Anpep	UTSW	7	79841731	missense	probably benign
R5593:Anpep	UTSW	7	79842046	missense	probably benign	0.04
R5778:Anpep	UTSW	7	79836391	missense	probably benign	0.00
R5852:Anpep	UTSW	7	79838972	nonsense	probably null
R5906:Anpep	UTSW	7	79833675	missense	probably benign
R6164:Anpep	UTSW	7	79842205	missense	possibly damaging	0.68
R6254:Anpep	UTSW	7	79839233	missense	probably damaging	1.00
R6380:Anpep	UTSW	7	79841896	missense	probably benign	0.04
R6594:Anpep	UTSW	7	79841361	splice site	probably null
R6746:Anpep	UTSW	7	79839185	splice site	probably null
R6920:Anpep	UTSW	7	79825349	missense	probably damaging	1.00
R7060:Anpep	UTSW	7	79841794	missense	probably benign	0.33
R7072:Anpep	UTSW	7	79835379	missense	possibly damaging	0.58
R7095:Anpep	UTSW	7	79842202	missense	possibly damaging	0.87
R7102:Anpep	UTSW	7	79836313	missense	probably benign	0.00
R7178:Anpep	UTSW	7	79840988	missense	probably benign
R7223:Anpep	UTSW	7	79825310	missense	probably damaging	1.00
R7344:Anpep	UTSW	7	79838650	missense	possibly damaging	0.60
R7441:Anpep	UTSW	7	79827644	missense	possibly damaging	0.93
R7479:Anpep	UTSW	7	79835370	missense	probably benign	0.11
R7503:Anpep	UTSW	7	79826637	missense	probably damaging	1.00
R7683:Anpep	UTSW	7	79839198	missense	probably damaging	0.98
R7912:Anpep	UTSW	7	79838426	missense	probably benign	0.00
R7935:Anpep	UTSW	7	79826961	missense	possibly damaging	0.46
R8036:Anpep	UTSW	7	79841898	missense	probably benign	0.11
R8039:Anpep	UTSW	7	79839400	critical splice donor site	probably null
R8470:Anpep	UTSW	7	79839521	missense	probably benign	0.16
R8549:Anpep	UTSW	7	79840896	missense	probably benign	0.00
R8723:Anpep	UTSW	7	79838938	missense	probably damaging	1.00
R8726:Anpep	UTSW	7	79840893	missense	probably benign	0.00
R9042:Anpep	UTSW	7	79838762	missense	probably damaging	0.99
R9151:Anpep	UTSW	7	79842037	missense	probably benign	0.31
R9200:Anpep	UTSW	7	79841122	missense	probably benign	0.00
R9216:Anpep	UTSW	7	79836301	missense	possibly damaging	0.49
Z1176:Anpep	UTSW	7	79827639	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TAAGTGGGAAAGCTCAGCAC -3'
(R):5'- AGTTTTCCACCTGCAGAGGG -3'

Sequencing Primer
(F):5'- AGCTCAGCACGGGGATG -3'
(R):5'- AGGTAGTACCAAGCGCCC -3'

Posted On

2018-03-15