Mutagenetix > Incidental Mutations

Incidental Mutation 'R6284:Tnrc6a'

508111

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6a

Ensembl Gene

ENSMUSG00000052707

Gene Name

trinucleotide repeat containing 6a

Synonyms

CAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik

MMRRC Submission

Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene?

Probably essential (E-score: 0.832) question?

Stock #

R6284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123123885-123195296 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123171335 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 783 (S783P)

Ref Sequence

ENSEMBL: ENSMUSP00000091595 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206014] [ENSMUST00000206888]

Predicted Effect

probably damaging
Transcript: ENSMUST00000094053
AA Change: S783P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: S783P

Domain	Start	End	E-Value	Type
coiled coil region	5	54	N/A	INTRINSIC
low complexity region	69	92	N/A	INTRINSIC
low complexity region	93	113	N/A	INTRINSIC
low complexity region	281	294	N/A	INTRINSIC
low complexity region	430	443	N/A	INTRINSIC
low complexity region	568	590	N/A	INTRINSIC
internal_repeat_1	690	853	3.51e-6	PROSPERO
low complexity region	858	871	N/A	INTRINSIC
Pfam:Ago_hook	1028	1190	1.2e-29	PFAM
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1301	1316	N/A	INTRINSIC
low complexity region	1337	1376	N/A	INTRINSIC
low complexity region	1386	1392	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1439	1714	1.5e-126	PFAM
RRM	1717	1784	4.95e-2	SMART
low complexity region	1808	1820	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205449

Predicted Effect

probably benign
Transcript: ENSMUST00000205514

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205732

Predicted Effect

unknown
Transcript: ENSMUST00000205760
AA Change: S235P

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205789

Predicted Effect

probably benign
Transcript: ENSMUST00000206014

Predicted Effect

probably benign
Transcript: ENSMUST00000206888

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206922

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211170

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]

Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	G	T	6: 72,347,454	G16C	probably damaging	Het
Abca7	G	A	10: 80,004,410	V801I	probably benign	Het
Adgrl2	A	T	3: 148,826,507	L1030Q	probably damaging	Het
Akap1	T	C	11: 88,844,568	T423A	possibly damaging	Het
Anpep	T	A	7: 79,825,802	D111V	probably damaging	Het
Atm	T	A	9: 53,445,376		probably null	Het
Atp5a1	T	A	18: 77,778,468	S106T	probably benign	Het
Atp5k	T	C	5: 108,434,059	I20V	probably benign	Het
Atp6v0d2	T	A	4: 19,922,605		probably null	Het
Bclaf1	T	G	10: 20,322,160		probably null	Het
Bod1l	A	G	5: 41,818,787	V1728A	probably benign	Het
Braf	A	G	6: 39,688,282	F51L	possibly damaging	Het
Camsap2	A	G	1: 136,304,437	I140T	possibly damaging	Het
Ccdc24	A	T	4: 117,869,653		probably null	Het
Cdh26	G	C	2: 178,449,884	G79R	probably damaging	Het
Cenpf	A	G	1: 189,652,742	L2447P	probably damaging	Het
Cfap74	T	C	4: 155,451,796	F863L	probably damaging	Het
Clstn2	C	T	9: 97,454,674	G917S	probably benign	Het
Col6a6	A	T	9: 105,727,227		probably null	Het
Cul5	G	A	9: 53,623,735	P596L	probably damaging	Het
Dst	A	T	1: 34,229,085	R2863W	probably damaging	Het
Dthd1	A	G	5: 62,814,041	E69G	possibly damaging	Het
Erich2	T	A	2: 70,539,684	I402N	probably damaging	Het
Fam160a1	G	A	3: 85,672,688	P737S	probably benign	Het
Fam162b	T	C	10: 51,585,502	K155R	probably damaging	Het
Glb1l2	A	T	9: 26,767,448	S466T	probably benign	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gm5724	T	C	6: 141,725,393	D451G	probably damaging	Het
Ikbkap	A	T	4: 56,762,281	I1106K	probably damaging	Het
Kazn	G	A	4: 142,117,197	L402F	probably benign	Het
Kcnj13	A	T	1: 87,386,886	S205T	probably damaging	Het
Lama1	T	A	17: 67,810,096	V2462E	probably damaging	Het
Lce1b	A	C	3: 92,656,104	C41G	unknown	Het
Lyar	T	A	5: 38,225,995	W77R	probably damaging	Het
March11	G	A	15: 26,409,346	R377Q	probably benign	Het
Mis18bp1	A	G	12: 65,138,787	F869L	probably benign	Het
Myom1	T	A	17: 71,022,892	Y6*	probably null	Het
Myzap	T	C	9: 71,558,925	I150V	probably benign	Het
Nop14	C	T	5: 34,641,491		probably null	Het
Oprl1	T	A	2: 181,717,991		probably benign	Het
Pacsin1	T	C	17: 27,708,504	L432P	probably damaging	Het
Peak1	A	G	9: 56,260,296	L116P	probably benign	Het
Plcb2	C	T	2: 118,717,301	V482M	probably benign	Het
Pnliprp1	T	A	19: 58,734,984	I269N	probably damaging	Het
Pnpla7	C	A	2: 25,016,618	D664E	possibly damaging	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Rps6kb2	G	T	19: 4,161,187	T113K	probably benign	Het
Rrp7a	A	T	15: 83,121,860	I63N	probably damaging	Het
Slc29a1	A	G	17: 45,589,921		probably null	Het
Stxbp5	A	C	10: 9,767,179	S1059A	probably benign	Het
Stxbp5	C	A	10: 9,767,187	G1056V	probably damaging	Het
Taldo1	T	A	7: 141,398,583	S149T	possibly damaging	Het
Tlr1	T	C	5: 64,927,099	D45G	possibly damaging	Het
Trap1	A	G	16: 4,060,809	Y220H	probably benign	Het
Trpc6	A	G	9: 8,643,600	D462G	possibly damaging	Het
Ttc21a	A	G	9: 119,943,962	E235G	probably damaging	Het
Tubb4a	A	G	17: 57,080,833	Y398H	probably damaging	Het
Ube2z	A	G	11: 96,050,407	F303S	probably damaging	Het
Vmn1r211	A	G	13: 22,852,084	S138P	probably damaging	Het
Zfp93	T	A	7: 24,275,629	C346*	probably null	Het
Zfp938	A	T	10: 82,227,566	S52R	possibly damaging	Het
Zp1	A	T	19: 10,916,503	L446Q	probably damaging	Het

Other mutations in Tnrc6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Tnrc6a	APN	7	123170780	missense	probably benign	0.04
IGL00580:Tnrc6a	APN	7	123174278	missense	probably damaging	1.00
IGL01309:Tnrc6a	APN	7	123171494	missense	probably benign	0.04
IGL02004:Tnrc6a	APN	7	123181366	missense	possibly damaging	0.57
IGL02142:Tnrc6a	APN	7	123152191	intron	probably benign
IGL02220:Tnrc6a	APN	7	123170456	missense	probably benign
IGL02436:Tnrc6a	APN	7	123184215	nonsense	probably null
IGL02670:Tnrc6a	APN	7	123171312	missense	possibly damaging	0.92
IGL02743:Tnrc6a	APN	7	123171473	missense	probably damaging	1.00
0152:Tnrc6a	UTSW	7	123180654	missense	probably damaging	1.00
R0008:Tnrc6a	UTSW	7	123170394	missense	probably benign	0.00
R0008:Tnrc6a	UTSW	7	123170394	missense	probably benign	0.00
R0369:Tnrc6a	UTSW	7	123170860	missense	probably damaging	1.00
R0512:Tnrc6a	UTSW	7	123186728	splice site	probably benign
R0566:Tnrc6a	UTSW	7	123170913	missense	probably benign	0.00
R0600:Tnrc6a	UTSW	7	123171816	missense	probably benign	0.14
R0751:Tnrc6a	UTSW	7	123170340	missense	possibly damaging	0.73
R1184:Tnrc6a	UTSW	7	123170340	missense	possibly damaging	0.73
R1319:Tnrc6a	UTSW	7	123184251	missense	probably benign	0.02
R1405:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R1405:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R1585:Tnrc6a	UTSW	7	123176875	missense	probably benign	0.08
R1709:Tnrc6a	UTSW	7	123169982	missense	probably benign	0.10
R1776:Tnrc6a	UTSW	7	123171297	missense	probably damaging	1.00
R1791:Tnrc6a	UTSW	7	123192917	missense	possibly damaging	0.47
R1807:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R1876:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R2010:Tnrc6a	UTSW	7	123171046	missense	probably benign	0.26
R2086:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R2089:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2091:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2091:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2511:Tnrc6a	UTSW	7	123171092	missense	probably damaging	1.00
R2830:Tnrc6a	UTSW	7	123192949	makesense	probably null
R2850:Tnrc6a	UTSW	7	123179800	missense	probably damaging	1.00
R3916:Tnrc6a	UTSW	7	123181384	missense	probably damaging	1.00
R4028:Tnrc6a	UTSW	7	123170121	missense	probably damaging	1.00
R4235:Tnrc6a	UTSW	7	123171680	missense	probably benign	0.00
R4439:Tnrc6a	UTSW	7	123152182	nonsense	probably null
R4525:Tnrc6a	UTSW	7	123179782	missense	probably benign
R4578:Tnrc6a	UTSW	7	123184221	missense	possibly damaging	0.89
R4613:Tnrc6a	UTSW	7	123184289	critical splice donor site	probably null
R4711:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R4722:Tnrc6a	UTSW	7	123192090	missense	possibly damaging	0.78
R4746:Tnrc6a	UTSW	7	123189997	missense	probably damaging	1.00
R4892:Tnrc6a	UTSW	7	123169911	missense	probably damaging	1.00
R4942:Tnrc6a	UTSW	7	123192613	missense	probably damaging	0.99
R4967:Tnrc6a	UTSW	7	123189872	missense	probably damaging	1.00
R5064:Tnrc6a	UTSW	7	123186723	critical splice donor site	probably null
R5239:Tnrc6a	UTSW	7	123186619	missense	probably benign
R5604:Tnrc6a	UTSW	7	123174236	missense	probably damaging	0.97
R5805:Tnrc6a	UTSW	7	123170076	missense	probably damaging	0.97
R5942:Tnrc6a	UTSW	7	123186665	missense	probably damaging	1.00
R5988:Tnrc6a	UTSW	7	123182380	missense	probably damaging	0.96
R6212:Tnrc6a	UTSW	7	123143742	splice site	probably null
R6417:Tnrc6a	UTSW	7	123171074	missense	probably benign	0.01
R6420:Tnrc6a	UTSW	7	123171074	missense	probably benign	0.01
R6575:Tnrc6a	UTSW	7	123169910	missense	probably damaging	1.00
R6760:Tnrc6a	UTSW	7	123171999	missense	probably damaging	1.00
R6886:Tnrc6a	UTSW	7	123187445	missense	probably benign	0.17
R6968:Tnrc6a	UTSW	7	123182427	missense	probably benign	0.05
R7216:Tnrc6a	UTSW	7	123171495	missense	probably benign	0.01
R7260:Tnrc6a	UTSW	7	123186590	missense	probably benign	0.36
R7299:Tnrc6a	UTSW	7	123170913	missense	probably benign
R7322:Tnrc6a	UTSW	7	123171508	missense	probably benign	0.09
R7500:Tnrc6a	UTSW	7	123173450	intron	probably null
R7872:Tnrc6a	UTSW	7	123179834	missense	probably damaging	0.99
R7955:Tnrc6a	UTSW	7	123179834	missense	probably damaging	0.99
X0064:Tnrc6a	UTSW	7	123169798	missense	probably benign	0.28
Z1176:Tnrc6a	UTSW	7	123162496	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGGGACAGACTCCTATTAAG -3'
(R):5'- ATCACCGGCAGAAATGGACC -3'

Sequencing Primer
(F):5'- CAGAATACTGCCTGGGATACAG -3'
(R):5'- CGGCAGAAATGGACCAACCTTG -3'

Posted On

2018-03-15