Incidental Mutation 'R6284:Taldo1'
List |< first << previous [record 52 of 63] next >> last >|
ID508112
Institutional Source Beutler Lab
Gene Symbol Taldo1
Ensembl Gene ENSMUSG00000025503
Gene Nametransaldolase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141392199-141402968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141398583 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 149 (S149T)
Ref Sequence ENSEMBL: ENSMUSP00000147332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026576] [ENSMUST00000211654]
Predicted Effect probably benign
Transcript: ENSMUST00000026576
AA Change: S104T

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026576
Gene: ENSMUSG00000025503
AA Change: S104T

DomainStartEndE-ValueType
Pfam:Transaldolase 24 326 1.2e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141793
Predicted Effect possibly damaging
Transcript: ENSMUST00000211654
AA Change: S149T

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211759
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a key enzyme of the nonoxidative pentose phosphate pathway that provides ribose-5-phosphate for nucleic acid synthesis and nicotinamide adenine dinucleotide phosphate (NADPH) for lipid biosynthesis. The encoded protein is important for maintaining structure and function of mitochondria. Studies in knockout mice identify that deficiency of this gene product is a cause of sperm dysmotility and male infertility. Deficiency of this protein has also been identified as a cause of hepatocarcinogenesis in mice. Two related pseudogenes have been identified on chromosome 10. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous mutation of this gene results in male infertility due to defective sperm motility because of functional and structural defects of mitochondria in the sperm. Heterozygous mice show reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Taldo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Taldo1 APN 7 141402734 splice site probably benign
R1470:Taldo1 UTSW 7 141398587 missense probably damaging 1.00
R1470:Taldo1 UTSW 7 141398587 missense probably damaging 1.00
R2060:Taldo1 UTSW 7 141396154 missense probably damaging 1.00
R2243:Taldo1 UTSW 7 141392304 missense probably damaging 0.99
R5610:Taldo1 UTSW 7 141392292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGGTTACCCCAACGCCTTC -3'
(R):5'- GACCAGCCATTAGTCAGAAAGCTC -3'

Sequencing Primer
(F):5'- CATCATAGATGGTTGTGAGCCACC -3'
(R):5'- GCCATTAGTCAGAAAGCTCTAGAAC -3'
Posted On2018-03-15