Incidental Mutation 'R6284:Glb1l2'
List |< first << previous [record 26 of 63] next >> last >|
ID508114
Institutional Source Beutler Lab
Gene Symbol Glb1l2
Ensembl Gene ENSMUSG00000036395
Gene Namegalactosidase, beta 1-like 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location26763044-26806468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26767448 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 466 (S466T)
Ref Sequence ENSEMBL: ENSMUSP00000124415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040398] [ENSMUST00000066560] [ENSMUST00000159799] [ENSMUST00000162252] [ENSMUST00000162702]
Predicted Effect probably benign
Transcript: ENSMUST00000040398
AA Change: S475T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000047128
Gene: ENSMUSG00000036395
AA Change: S475T

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_hydro_35 52 384 6.6e-118 PFAM
Pfam:Glyco_hydro_42 84 243 6.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066560
AA Change: S459T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066770
Gene: ENSMUSG00000036395
AA Change: S459T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Glyco_hydro_35 53 368 6.3e-121 PFAM
Pfam:Glyco_hydro_42 68 227 6.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159527
SMART Domains Protein: ENSMUSP00000125401
Gene: ENSMUSG00000045994

DomainStartEndE-ValueType
Pfam:Glyco_transf_43 48 259 2.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159799
SMART Domains Protein: ENSMUSP00000124438
Gene: ENSMUSG00000045994

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Glyco_transf_43 118 329 6.6e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160458
Predicted Effect probably benign
Transcript: ENSMUST00000162252
AA Change: S466T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124415
Gene: ENSMUSG00000036395
AA Change: S466T

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
Pfam:Glyco_hydro_35 60 375 5.3e-121 PFAM
Pfam:Glyco_hydro_42 75 234 5.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162702
AA Change: S338T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125022
Gene: ENSMUSG00000036395
AA Change: S338T

DomainStartEndE-ValueType
Pfam:Glyco_hydro_35 27 247 1.4e-67 PFAM
Meta Mutation Damage Score 0.0867 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous mutant mice show decreased mean white blood cell and lymphocyte counts and a decreased mean percentage of natural killer cells. Male mutant mice exhibit impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Glb1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Glb1l2 APN 9 26768418 critical splice donor site probably null
IGL02045:Glb1l2 APN 9 26796545 missense probably benign 0.00
IGL02172:Glb1l2 APN 9 26769086 missense probably damaging 0.98
IGL02372:Glb1l2 APN 9 26796476 missense probably damaging 1.00
IGL02831:Glb1l2 APN 9 26767450 missense probably benign 0.00
IGL03057:Glb1l2 APN 9 26806290 splice site probably benign
IGL03101:Glb1l2 APN 9 26765125 missense probably damaging 1.00
IGL03348:Glb1l2 APN 9 26765680 missense probably benign
P4717OSA:Glb1l2 UTSW 9 26766021 missense probably damaging 1.00
PIT4362001:Glb1l2 UTSW 9 26773981 missense probably benign 0.05
R0219:Glb1l2 UTSW 9 26806322 missense probably benign 0.33
R0414:Glb1l2 UTSW 9 26765104 nonsense probably null
R0418:Glb1l2 UTSW 9 26794101 missense probably damaging 1.00
R0791:Glb1l2 UTSW 9 26769751 missense possibly damaging 0.96
R1165:Glb1l2 UTSW 9 26794101 missense probably damaging 1.00
R1514:Glb1l2 UTSW 9 26769124 splice site probably benign
R1589:Glb1l2 UTSW 9 26769038 nonsense probably null
R1926:Glb1l2 UTSW 9 26771066 missense probably damaging 0.96
R2928:Glb1l2 UTSW 9 26768426 missense probably benign 0.10
R3441:Glb1l2 UTSW 9 26780742 missense probably damaging 1.00
R3442:Glb1l2 UTSW 9 26780742 missense probably damaging 1.00
R3706:Glb1l2 UTSW 9 26771020 splice site probably benign
R3814:Glb1l2 UTSW 9 26771034 missense probably benign 0.00
R5079:Glb1l2 UTSW 9 26771109 missense probably benign
R5308:Glb1l2 UTSW 9 26764759 missense probably damaging 1.00
R5310:Glb1l2 UTSW 9 26796866 intron probably benign
R5746:Glb1l2 UTSW 9 26796790 missense probably benign 0.01
R5969:Glb1l2 UTSW 9 26780742 missense probably damaging 1.00
R5998:Glb1l2 UTSW 9 26766003 missense possibly damaging 0.68
R6249:Glb1l2 UTSW 9 26765554 intron probably benign
R6469:Glb1l2 UTSW 9 26796532 missense probably benign 0.03
R7054:Glb1l2 UTSW 9 26765127 missense probably null 0.51
R8103:Glb1l2 UTSW 9 26765684 missense probably benign
X0020:Glb1l2 UTSW 9 26767733 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CACCTGGGAATCTGTGTTCC -3'
(R):5'- AGTTGGCATGATCTTTCCCC -3'

Sequencing Primer
(F):5'- TGGTCACAAAGCTACCTGTG -3'
(R):5'- GGCATGATCTTTCCCCCATAAC -3'
Posted On2018-03-15