Incidental Mutation 'R6284:Myzap'
List |< first << previous [record 38 of 63] next >> last >|
ID508117
Institutional Source Beutler Lab
Gene Symbol Myzap
Ensembl Gene ENSMUSG00000041361
Gene Namemyocardial zonula adherens protein
SynonymsMyozap, Grinl1a7, Gcom1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R6284 (G1)
Quality Score111.008
Status Validated
Chromosome9
Chromosomal Location71504347-71592360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71558925 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 150 (I150V)
Ref Sequence ENSEMBL: ENSMUSP00000131267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093823] [ENSMUST00000163998] [ENSMUST00000164962] [ENSMUST00000165936] [ENSMUST00000166843] [ENSMUST00000169573] [ENSMUST00000171977]
Predicted Effect probably benign
Transcript: ENSMUST00000093823
AA Change: I150V

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000091342
Gene: ENSMUSG00000041361
AA Change: I150V

DomainStartEndE-ValueType
Pfam:GCOM2 96 416 1.1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163708
Predicted Effect probably benign
Transcript: ENSMUST00000163998
AA Change: I150V

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131267
Gene: ENSMUSG00000092137
AA Change: I150V

DomainStartEndE-ValueType
coiled coil region 105 138 N/A INTRINSIC
coiled coil region 187 415 N/A INTRINSIC
coiled coil region 483 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164962
AA Change: I150V

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131353
Gene: ENSMUSG00000092137
AA Change: I150V

DomainStartEndE-ValueType
Pfam:GCOM2 96 390 7.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165936
AA Change: I150V

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127356
Gene: ENSMUSG00000092137
AA Change: I150V

DomainStartEndE-ValueType
Pfam:GCOM2 96 379 4.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166843
AA Change: I150V

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128698
Gene: ENSMUSG00000092137
AA Change: I150V

DomainStartEndE-ValueType
Pfam:GCOM2 96 416 4.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169573
AA Change: I150V

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127028
Gene: ENSMUSG00000041361
AA Change: I150V

DomainStartEndE-ValueType
Pfam:GCOM2 96 388 6.6e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171977
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is abundantly expressed in cardiac tissue. The encoded protein localizes to intercalated discs in cardiomyocytes and functions as an activator of Rho-dependent serum-response factor signaling. Alternative splicing results in multiple transcript variants. Readthrough transcription also exists between this gene and the neighboring downstream gene POLR2M (polymerase (RNA) II (DNA directed) polypeptide M) and is represented with GeneID: 145781. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous KO results in a maladaptive response to increased biomechanical stress, resulting in adverse cardiac remodeling, contractile dysfunction, heart failure, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Myzap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Myzap APN 9 71555671 missense probably benign 0.06
IGL01077:Myzap APN 9 71546760 missense probably damaging 1.00
IGL01478:Myzap APN 9 71515067 critical splice donor site probably null
IGL02146:Myzap APN 9 71564448 missense probably benign 0.43
IGL02715:Myzap APN 9 71515115 nonsense probably null
IGL03218:Myzap APN 9 71555589 missense probably benign 0.40
R0674:Myzap UTSW 9 71515144 missense probably damaging 1.00
R2298:Myzap UTSW 9 71548757 missense probably damaging 0.98
R4463:Myzap UTSW 9 71555651 missense probably benign 0.00
R4470:Myzap UTSW 9 71592281 unclassified probably benign
R4548:Myzap UTSW 9 71550246 missense possibly damaging 0.67
R4841:Myzap UTSW 9 71548755 missense probably damaging 1.00
R4842:Myzap UTSW 9 71548755 missense probably damaging 1.00
R6307:Myzap UTSW 9 71558864 missense possibly damaging 0.92
R7427:Myzap UTSW 9 71505183 missense probably benign 0.00
R7489:Myzap UTSW 9 71561038 missense probably benign 0.09
X0018:Myzap UTSW 9 71550295 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCAGAAACCGTCTTTACTGTGG -3'
(R):5'- CCCCAGATGTTGGTTTGTATGC -3'

Sequencing Primer
(F):5'- CTGTGCTTAAAGGACCATGACAGATC -3'
(R):5'- CCCAGATGTTGGTTTGTATGCTATAG -3'
Posted On2018-03-15