Mutagenetix > Incidental Mutation

Incidental Mutation 'R6284:Clstn2'

508118

Institutional Source

Beutler Lab

Gene Symbol

Clstn2

Ensembl Gene

ENSMUSG00000032452

Gene Name

calsyntenin 2

Synonyms

Cst-2, CSTN2, CS2, 2900042C18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

97444395-98033181 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 97454674 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 917 (G917S)

Ref Sequence

ENSEMBL: ENSMUSP00000124081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035027] [ENSMUST00000162295]

AlphaFold

Q9ER65

Predicted Effect

probably benign
Transcript: ENSMUST00000035027
AA Change: G917S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000035027
Gene: ENSMUSG00000032452
AA Change: G917S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	67	160	2e-10	SMART
CA	183	261	1.18e-3	SMART
SCOP:d1a8d_1	358	538	5e-21	SMART
Blast:LamG	380	529	3e-41	BLAST
transmembrane domain	835	857	N/A	INTRINSIC
low complexity region	901	935	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162295
AA Change: G917S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000124081
Gene: ENSMUSG00000032452
AA Change: G917S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	67	160	2e-10	SMART
CA	183	261	1.18e-3	SMART
Pfam:Laminin_G_3	356	533	1.4e-9	PFAM
transmembrane domain	835	857	N/A	INTRINSIC
low complexity region	901	935	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

PHENOTYPE: Homozygous KO mice display deficiency in spatial learning and memory in Morris water and Barnes maze tasks and increased locomotor activity in open field test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	G	T	6: 72,347,454	G16C	probably damaging	Het
Abca7	G	A	10: 80,004,410	V801I	probably benign	Het
Adgrl2	A	T	3: 148,826,507	L1030Q	probably damaging	Het
Akap1	T	C	11: 88,844,568	T423A	possibly damaging	Het
Anpep	T	A	7: 79,825,802	D111V	probably damaging	Het
Atm	T	A	9: 53,445,376		probably null	Het
Atp5a1	T	A	18: 77,778,468	S106T	probably benign	Het
Atp5k	T	C	5: 108,434,059	I20V	probably benign	Het
Atp6v0d2	T	A	4: 19,922,605		probably null	Het
Bclaf1	T	G	10: 20,322,160		probably null	Het
Bod1l	A	G	5: 41,818,787	V1728A	probably benign	Het
Braf	A	G	6: 39,688,282	F51L	possibly damaging	Het
Camsap2	A	G	1: 136,304,437	I140T	possibly damaging	Het
Ccdc24	A	T	4: 117,869,653		probably null	Het
Cdh26	G	C	2: 178,449,884	G79R	probably damaging	Het
Cenpf	A	G	1: 189,652,742	L2447P	probably damaging	Het
Cfap74	T	C	4: 155,451,796	F863L	probably damaging	Het
Col6a6	A	T	9: 105,727,227		probably null	Het
Cul5	G	A	9: 53,623,735	P596L	probably damaging	Het
Dst	A	T	1: 34,229,085	R2863W	probably damaging	Het
Dthd1	A	G	5: 62,814,041	E69G	possibly damaging	Het
Erich2	T	A	2: 70,539,684	I402N	probably damaging	Het
Fam160a1	G	A	3: 85,672,688	P737S	probably benign	Het
Fam162b	T	C	10: 51,585,502	K155R	probably damaging	Het
Glb1l2	A	T	9: 26,767,448	S466T	probably benign	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gm5724	T	C	6: 141,725,393	D451G	probably damaging	Het
Ikbkap	A	T	4: 56,762,281	I1106K	probably damaging	Het
Kazn	G	A	4: 142,117,197	L402F	probably benign	Het
Kcnj13	A	T	1: 87,386,886	S205T	probably damaging	Het
Lama1	T	A	17: 67,810,096	V2462E	probably damaging	Het
Lce1b	A	C	3: 92,656,104	C41G	unknown	Het
Lyar	T	A	5: 38,225,995	W77R	probably damaging	Het
March11	G	A	15: 26,409,346	R377Q	probably benign	Het
Mis18bp1	A	G	12: 65,138,787	F869L	probably benign	Het
Myom1	T	A	17: 71,022,892	Y6*	probably null	Het
Myzap	T	C	9: 71,558,925	I150V	probably benign	Het
Nop14	C	T	5: 34,641,491		probably null	Het
Oprl1	T	A	2: 181,717,991		probably benign	Het
Pacsin1	T	C	17: 27,708,504	L432P	probably damaging	Het
Peak1	A	G	9: 56,260,296	L116P	probably benign	Het
Plcb2	C	T	2: 118,717,301	V482M	probably benign	Het
Pnliprp1	T	A	19: 58,734,984	I269N	probably damaging	Het
Pnpla7	C	A	2: 25,016,618	D664E	possibly damaging	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Rps6kb2	G	T	19: 4,161,187	T113K	probably benign	Het
Rrp7a	A	T	15: 83,121,860	I63N	probably damaging	Het
Slc29a1	A	G	17: 45,589,921		probably null	Het
Stxbp5	A	C	10: 9,767,179	S1059A	probably benign	Het
Stxbp5	C	A	10: 9,767,187	G1056V	probably damaging	Het
Taldo1	T	A	7: 141,398,583	S149T	possibly damaging	Het
Tlr1	T	C	5: 64,927,099	D45G	possibly damaging	Het
Tnrc6a	T	C	7: 123,171,335	S783P	probably damaging	Het
Trap1	A	G	16: 4,060,809	Y220H	probably benign	Het
Trpc6	A	G	9: 8,643,600	D462G	possibly damaging	Het
Ttc21a	A	G	9: 119,943,962	E235G	probably damaging	Het
Tubb4a	A	G	17: 57,080,833	Y398H	probably damaging	Het
Ube2z	A	G	11: 96,050,407	F303S	probably damaging	Het
Vmn1r211	A	G	13: 22,852,084	S138P	probably damaging	Het
Zfp93	T	A	7: 24,275,629	C346*	probably null	Het
Zfp938	A	T	10: 82,227,566	S52R	possibly damaging	Het
Zp1	A	T	19: 10,916,503	L446Q	probably damaging	Het

Other mutations in Clstn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Clstn2	APN	9	97582452	splice site	probably benign
IGL00563:Clstn2	APN	9	97582452	splice site	probably benign
IGL00733:Clstn2	APN	9	97483049	missense	probably damaging	1.00
IGL01303:Clstn2	APN	9	97483075	nonsense	probably null
IGL01935:Clstn2	APN	9	97463468	missense	probably damaging	1.00
IGL02157:Clstn2	APN	9	97541875	missense	probably benign
IGL02974:Clstn2	APN	9	97532707	missense	probably damaging	1.00
IGL03164:Clstn2	APN	9	97799409	missense	possibly damaging	0.50
IGL03298:Clstn2	APN	9	97456572	missense	probably damaging	1.00
R0653:Clstn2	UTSW	9	97458204	missense	probably damaging	1.00
R0845:Clstn2	UTSW	9	97570628	missense	probably benign	0.39
R0992:Clstn2	UTSW	9	97445712	missense	probably benign	0.00
R1105:Clstn2	UTSW	9	97583499	splice site	probably null
R1112:Clstn2	UTSW	9	97458228	missense	possibly damaging	0.92
R1264:Clstn2	UTSW	9	97457609	missense	probably benign	0.28
R1275:Clstn2	UTSW	9	97457430	missense	probably benign	0.00
R1329:Clstn2	UTSW	9	97458174	missense	probably damaging	1.00
R1396:Clstn2	UTSW	9	97461393	missense	probably benign	0.02
R1556:Clstn2	UTSW	9	97456505	missense	probably benign	0.41
R1703:Clstn2	UTSW	9	97458237	missense	possibly damaging	0.90
R1837:Clstn2	UTSW	9	97583540	missense	probably benign	0.00
R2911:Clstn2	UTSW	9	97532722	missense	probably damaging	1.00
R3434:Clstn2	UTSW	9	97454715	missense	probably benign	0.17
R3771:Clstn2	UTSW	9	97582562	missense	probably damaging	1.00
R3772:Clstn2	UTSW	9	97582562	missense	probably damaging	1.00
R3854:Clstn2	UTSW	9	97463595	nonsense	probably null
R4049:Clstn2	UTSW	9	97457560	missense	possibly damaging	0.59
R4334:Clstn2	UTSW	9	97463528	missense	probably damaging	1.00
R4705:Clstn2	UTSW	9	97463559	missense	possibly damaging	0.95
R4755:Clstn2	UTSW	9	97445673	missense	probably benign	0.01
R4884:Clstn2	UTSW	9	97799395	missense	probably damaging	1.00
R5017:Clstn2	UTSW	9	97483086	missense	probably damaging	1.00
R5076:Clstn2	UTSW	9	97483079	missense	probably damaging	1.00
R5122:Clstn2	UTSW	9	97461421	missense	probably damaging	1.00
R5155:Clstn2	UTSW	9	97456431	missense	probably benign	0.02
R5560:Clstn2	UTSW	9	97469819	missense	possibly damaging	0.95
R6009:Clstn2	UTSW	9	97456526	missense	probably benign	0.05
R6011:Clstn2	UTSW	9	97456526	missense	probably benign	0.05
R6029:Clstn2	UTSW	9	97456581	missense	probably benign	0.00
R6093:Clstn2	UTSW	9	97458210	missense	probably damaging	1.00
R6676:Clstn2	UTSW	9	97461531	missense	probably damaging	1.00
R6902:Clstn2	UTSW	9	97469822	missense	probably damaging	1.00
R6946:Clstn2	UTSW	9	97469822	missense	probably damaging	1.00
R6966:Clstn2	UTSW	9	97526406	nonsense	probably null
R7329:Clstn2	UTSW	9	97461369	missense	probably benign	0.00
R7330:Clstn2	UTSW	9	97461369	missense	probably benign	0.00
R7382:Clstn2	UTSW	9	97799398	nonsense	probably null
R7410:Clstn2	UTSW	9	97541867	missense	probably benign	0.06
R7549:Clstn2	UTSW	9	97582544	missense	probably benign	0.01
R7879:Clstn2	UTSW	9	97469764	missense	possibly damaging	0.90
R8070:Clstn2	UTSW	9	97799470	missense	possibly damaging	0.79
R8193:Clstn2	UTSW	9	97583630	missense	probably damaging	1.00
R8422:Clstn2	UTSW	9	97458186	missense	probably benign	0.39
R9190:Clstn2	UTSW	9	97532762	missense	probably damaging	1.00
R9221:Clstn2	UTSW	9	97461342	missense	probably benign	0.00
R9305:Clstn2	UTSW	9	97461484	missense	probably damaging	1.00
R9347:Clstn2	UTSW	9	97582601	missense	probably damaging	1.00
R9520:Clstn2	UTSW	9	97532710	missense	probably damaging	1.00
R9751:Clstn2	UTSW	9	97457650	missense	probably damaging	0.98
X0027:Clstn2	UTSW	9	97526399	missense	probably damaging	1.00
Z1177:Clstn2	UTSW	9	97461356	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGCTTGGGCATACATTGGG -3'
(R):5'- AGATCCTATCTCTGGGCAGG -3'

Sequencing Primer
(F):5'- TTGGGTTTTACAAAAGGGGCACAC -3'
(R):5'- ATCCTATCTCTGGGCAGGGTGAG -3'

Posted On

2018-03-15