Mutagenetix > Incidental Mutations

Incidental Mutation 'R6284:Col6a6'

508119

Institutional Source

Beutler Lab

Gene Symbol

Col6a6

Ensembl Gene

ENSMUSG00000043719

Gene Name

collagen, type VI, alpha 6

Synonyms

E330026B02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R6284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105687809-105828160 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 105727227 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125765 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]

Predicted Effect

probably null
Transcript: ENSMUST00000098441

SMART Domains

Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	3.3e-9	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000166431

SMART Domains

Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	9.3e-10	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195709

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (64/64)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	G	T	6: 72,347,454	G16C	probably damaging	Het
Abca7	G	A	10: 80,004,410	V801I	probably benign	Het
Adgrl2	A	T	3: 148,826,507	L1030Q	probably damaging	Het
Akap1	T	C	11: 88,844,568	T423A	possibly damaging	Het
Anpep	T	A	7: 79,825,802	D111V	probably damaging	Het
Atm	T	A	9: 53,445,376		probably null	Het
Atp5a1	T	A	18: 77,778,468	S106T	probably benign	Het
Atp5k	T	C	5: 108,434,059	I20V	probably benign	Het
Atp6v0d2	T	A	4: 19,922,605		probably null	Het
Bclaf1	T	G	10: 20,322,160		probably null	Het
Bod1l	A	G	5: 41,818,787	V1728A	probably benign	Het
Braf	A	G	6: 39,688,282	F51L	possibly damaging	Het
Camsap2	A	G	1: 136,304,437	I140T	possibly damaging	Het
Ccdc24	A	T	4: 117,869,653		probably null	Het
Cdh26	G	C	2: 178,449,884	G79R	probably damaging	Het
Cenpf	A	G	1: 189,652,742	L2447P	probably damaging	Het
Cfap74	T	C	4: 155,451,796	F863L	probably damaging	Het
Clstn2	C	T	9: 97,454,674	G917S	probably benign	Het
Cul5	G	A	9: 53,623,735	P596L	probably damaging	Het
Dst	A	T	1: 34,229,085	R2863W	probably damaging	Het
Dthd1	A	G	5: 62,814,041	E69G	possibly damaging	Het
Erich2	T	A	2: 70,539,684	I402N	probably damaging	Het
Fam160a1	G	A	3: 85,672,688	P737S	probably benign	Het
Fam162b	T	C	10: 51,585,502	K155R	probably damaging	Het
Glb1l2	A	T	9: 26,767,448	S466T	probably benign	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gm5724	T	C	6: 141,725,393	D451G	probably damaging	Het
Ikbkap	A	T	4: 56,762,281	I1106K	probably damaging	Het
Kazn	G	A	4: 142,117,197	L402F	probably benign	Het
Kcnj13	A	T	1: 87,386,886	S205T	probably damaging	Het
Lama1	T	A	17: 67,810,096	V2462E	probably damaging	Het
Lce1b	A	C	3: 92,656,104	C41G	unknown	Het
Lyar	T	A	5: 38,225,995	W77R	probably damaging	Het
March11	G	A	15: 26,409,346	R377Q	probably benign	Het
Mis18bp1	A	G	12: 65,138,787	F869L	probably benign	Het
Myom1	T	A	17: 71,022,892	Y6*	probably null	Het
Myzap	T	C	9: 71,558,925	I150V	probably benign	Het
Nop14	C	T	5: 34,641,491		probably null	Het
Oprl1	T	A	2: 181,717,991		probably benign	Het
Pacsin1	T	C	17: 27,708,504	L432P	probably damaging	Het
Peak1	A	G	9: 56,260,296	L116P	probably benign	Het
Plcb2	C	T	2: 118,717,301	V482M	probably benign	Het
Pnliprp1	T	A	19: 58,734,984	I269N	probably damaging	Het
Pnpla7	C	A	2: 25,016,618	D664E	possibly damaging	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Rps6kb2	G	T	19: 4,161,187	T113K	probably benign	Het
Rrp7a	A	T	15: 83,121,860	I63N	probably damaging	Het
Slc29a1	A	G	17: 45,589,921		probably null	Het
Stxbp5	A	C	10: 9,767,179	S1059A	probably benign	Het
Stxbp5	C	A	10: 9,767,187	G1056V	probably damaging	Het
Taldo1	T	A	7: 141,398,583	S149T	possibly damaging	Het
Tlr1	T	C	5: 64,927,099	D45G	possibly damaging	Het
Tnrc6a	T	C	7: 123,171,335	S783P	probably damaging	Het
Trap1	A	G	16: 4,060,809	Y220H	probably benign	Het
Trpc6	A	G	9: 8,643,600	D462G	possibly damaging	Het
Ttc21a	A	G	9: 119,943,962	E235G	probably damaging	Het
Tubb4a	A	G	17: 57,080,833	Y398H	probably damaging	Het
Ube2z	A	G	11: 96,050,407	F303S	probably damaging	Het
Vmn1r211	A	G	13: 22,852,084	S138P	probably damaging	Het
Zfp93	T	A	7: 24,275,629	C346*	probably null	Het
Zfp938	A	T	10: 82,227,566	S52R	possibly damaging	Het
Zp1	A	T	19: 10,916,503	L446Q	probably damaging	Het

Other mutations in Col6a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Col6a6	APN	9	105758191	critical splice acceptor site	probably null
IGL00768:Col6a6	APN	9	105782412	missense	probably benign	0.04
IGL00917:Col6a6	APN	9	105784254	splice site	probably benign
IGL01385:Col6a6	APN	9	105783666	missense	probably damaging	1.00
IGL01411:Col6a6	APN	9	105785958	nonsense	probably null
IGL01508:Col6a6	APN	9	105727166	splice site	probably benign
IGL01668:Col6a6	APN	9	105709271	missense	probably damaging	1.00
IGL01733:Col6a6	APN	9	105709255	missense	possibly damaging	0.92
IGL01932:Col6a6	APN	9	105689626	missense	probably benign	0.02
IGL01934:Col6a6	APN	9	105698659	critical splice donor site	probably null
IGL01944:Col6a6	APN	9	105783909	missense	probably damaging	1.00
IGL01980:Col6a6	APN	9	105780985	missense	probably damaging	0.96
IGL02114:Col6a6	APN	9	105767199	critical splice donor site	probably null
IGL02129:Col6a6	APN	9	105736340	splice site	probably benign
IGL02201:Col6a6	APN	9	105780995	missense	probably damaging	1.00
IGL02335:Col6a6	APN	9	105784101	missense	probably damaging	1.00
IGL02541:Col6a6	APN	9	105732216	missense	probably benign	0.05
IGL02574:Col6a6	APN	9	105782191	missense	probably damaging	1.00
IGL02649:Col6a6	APN	9	105727170	critical splice donor site	probably null
IGL02852:Col6a6	APN	9	105784073	missense	probably damaging	0.99
IGL03278:Col6a6	APN	9	105709452	missense	probably benign	0.01
IGL03327:Col6a6	APN	9	105767234	missense	possibly damaging	0.90
PIT4519001:Col6a6	UTSW	9	105732263	missense	probably benign	0.23
R0042:Col6a6	UTSW	9	105780697	missense	possibly damaging	0.89
R0046:Col6a6	UTSW	9	105748848	splice site	probably benign
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0140:Col6a6	UTSW	9	105702275	missense	probably damaging	1.00
R0278:Col6a6	UTSW	9	105767288	missense	possibly damaging	0.87
R0281:Col6a6	UTSW	9	105784116	missense	probably benign	0.13
R0382:Col6a6	UTSW	9	105755555	missense	probably damaging	0.98
R0389:Col6a6	UTSW	9	105784204	missense	probably benign	0.02
R0421:Col6a6	UTSW	9	105784206	missense	probably benign	0.02
R0502:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0503:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0600:Col6a6	UTSW	9	105761440	missense	probably damaging	1.00
R0626:Col6a6	UTSW	9	105777744	missense	probably benign	0.45
R0629:Col6a6	UTSW	9	105727165	splice site	probably benign
R0690:Col6a6	UTSW	9	105709486	missense	probably benign	0.01
R1155:Col6a6	UTSW	9	105782090	missense	possibly damaging	0.64
R1245:Col6a6	UTSW	9	105748910	missense	possibly damaging	0.62
R1253:Col6a6	UTSW	9	105774303	missense	probably null	0.98
R1263:Col6a6	UTSW	9	105709489	missense	probably benign	0.01
R1296:Col6a6	UTSW	9	105781091	missense	probably damaging	1.00
R1556:Col6a6	UTSW	9	105709473	missense	possibly damaging	0.82
R1600:Col6a6	UTSW	9	105778075	missense	probably damaging	1.00
R1612:Col6a6	UTSW	9	105777549	missense	probably damaging	1.00
R1613:Col6a6	UTSW	9	105732211	critical splice donor site	probably null
R1830:Col6a6	UTSW	9	105702270	missense	probably damaging	0.99
R1858:Col6a6	UTSW	9	105781102	missense	probably damaging	1.00
R1897:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R1944:Col6a6	UTSW	9	105709384	missense	probably damaging	1.00
R2366:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R2484:Col6a6	UTSW	9	105780804	missense	probably damaging	0.98
R3079:Col6a6	UTSW	9	105754223	missense	probably benign	0.01
R3176:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3276:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3429:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R3716:Col6a6	UTSW	9	105782174	missense	probably damaging	0.98
R3809:Col6a6	UTSW	9	105780692	missense	probably damaging	1.00
R3978:Col6a6	UTSW	9	105698879	missense	probably damaging	0.98
R4087:Col6a6	UTSW	9	105783956	missense	possibly damaging	0.68
R4382:Col6a6	UTSW	9	105783690	missense	probably damaging	1.00
R4516:Col6a6	UTSW	9	105698949	missense	possibly damaging	0.64
R4666:Col6a6	UTSW	9	105767342	missense	possibly damaging	0.93
R4905:Col6a6	UTSW	9	105767424	missense	probably damaging	1.00
R4923:Col6a6	UTSW	9	105788948	missense	probably damaging	1.00
R4951:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R5002:Col6a6	UTSW	9	105786093	missense	probably benign	0.00
R5111:Col6a6	UTSW	9	105709474	missense	possibly damaging	0.70
R5205:Col6a6	UTSW	9	105782033	missense	probably damaging	0.99
R5399:Col6a6	UTSW	9	105709107	missense	possibly damaging	0.50
R5475:Col6a6	UTSW	9	105774338	missense	probably null	0.79
R5491:Col6a6	UTSW	9	105738236	missense	probably damaging	0.98
R5758:Col6a6	UTSW	9	105761518	critical splice acceptor site	probably null
R5934:Col6a6	UTSW	9	105767075	missense	probably damaging	1.00
R6059:Col6a6	UTSW	9	105783917	missense	probably damaging	1.00
R6425:Col6a6	UTSW	9	105698865	missense	probably benign	0.21
R6464:Col6a6	UTSW	9	105788953	start codon destroyed	probably null	0.60
R6469:Col6a6	UTSW	9	105698691	missense	probably damaging	0.97
R6520:Col6a6	UTSW	9	105785825	missense	possibly damaging	0.89
R6552:Col6a6	UTSW	9	105698913	missense	probably damaging	1.00
R6750:Col6a6	UTSW	9	105783680	missense	probably damaging	1.00
R6813:Col6a6	UTSW	9	105783941	missense	probably benign	0.32
R7032:Col6a6	UTSW	9	105767508	missense	probably damaging	0.96
R7260:Col6a6	UTSW	9	105783969	missense	probably benign	0.00
R7472:Col6a6	UTSW	9	105782423	missense	probably damaging	1.00
R7541:Col6a6	UTSW	9	105767324	missense	probably damaging	1.00
R7640:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R7645:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R7716:Col6a6	UTSW	9	105783903	missense	possibly damaging	0.84
R7866:Col6a6	UTSW	9	105689561	missense	probably damaging	0.96
R8016:Col6a6	UTSW	9	105767528	missense	possibly damaging	0.73
R8043:Col6a6	UTSW	9	105699020	missense	probably damaging	0.98
R8073:Col6a6	UTSW	9	105781947	missense	probably benign	0.01
R8082:Col6a6	UTSW	9	105783930	nonsense	probably null
R8243:Col6a6	UTSW	9	105699269	missense	probably damaging	1.00
R8306:Col6a6	UTSW	9	105784073	missense	probably damaging	0.96
X0022:Col6a6	UTSW	9	105699332	missense	probably damaging	1.00
Z1176:Col6a6	UTSW	9	105780952	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105728255	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105788895	missense	probably null	0.24

Predicted Primers

PCR Primer
(F):5'- ACAGGACATCAGTAAGTGAACC -3'
(R):5'- GAAAGATGGCTGCATGTCCAG -3'

Sequencing Primer
(F):5'- AATGGTACCAGACCCCTT -3'
(R):5'- AGTAGCTGTAATTGTCATTTACAGGG -3'

Posted On

2018-03-15