Incidental Mutation 'R6284:Zfp938'
ID 508126
Institutional Source Beutler Lab
Gene Symbol Zfp938
Ensembl Gene ENSMUSG00000062931
Gene Name zinc finger protein 938
Synonyms B230315N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R6284 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 82224850-82241280 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 82227566 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 52 (S52R)
Ref Sequence ENSEMBL: ENSMUSP00000047110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041264] [ENSMUST00000156218]
AlphaFold E9Q9G3
Predicted Effect possibly damaging
Transcript: ENSMUST00000041264
AA Change: S52R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047110
Gene: ENSMUSG00000062931
AA Change: S52R

DomainStartEndE-ValueType
KRAB 4 64 5.28e-14 SMART
ZnF_C2H2 161 188 2.82e1 SMART
ZnF_C2H2 267 289 1.23e0 SMART
ZnF_C2H2 295 317 2.91e-2 SMART
ZnF_C2H2 323 345 2.4e-3 SMART
ZnF_C2H2 351 373 7.26e-3 SMART
ZnF_C2H2 379 401 4.65e-1 SMART
ZnF_C2H2 407 429 1.47e-3 SMART
ZnF_C2H2 435 457 5.59e-4 SMART
ZnF_C2H2 463 485 1.82e-3 SMART
ZnF_C2H2 491 513 3.63e-3 SMART
ZnF_C2H2 519 541 7.67e-2 SMART
ZnF_C2H2 547 569 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156218
AA Change: S52R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121613
Gene: ENSMUSG00000062931
AA Change: S52R

DomainStartEndE-ValueType
KRAB 4 64 5.28e-14 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Zfp938
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Zfp938 APN 10 82227521 utr 3 prime probably benign
IGL00743:Zfp938 APN 10 82226483 missense probably benign
IGL01764:Zfp938 APN 10 82227790 splice site probably benign
IGL01814:Zfp938 APN 10 82226218 missense probably benign
IGL02244:Zfp938 APN 10 82226072 missense possibly damaging 0.86
IGL02865:Zfp938 APN 10 82226192 missense probably benign 0.33
R0372:Zfp938 UTSW 10 82227828 missense probably damaging 1.00
R0666:Zfp938 UTSW 10 82225772 missense probably damaging 1.00
R0964:Zfp938 UTSW 10 82225419 missense probably benign 0.00
R1453:Zfp938 UTSW 10 82227798 critical splice donor site probably null
R1672:Zfp938 UTSW 10 82225148 missense probably benign
R1929:Zfp938 UTSW 10 82225547 missense probably damaging 1.00
R1959:Zfp938 UTSW 10 82225631 missense probably damaging 1.00
R2127:Zfp938 UTSW 10 82226042 missense probably benign
R2271:Zfp938 UTSW 10 82225547 missense probably damaging 1.00
R2900:Zfp938 UTSW 10 82225506 missense possibly damaging 0.92
R4502:Zfp938 UTSW 10 82226271 missense possibly damaging 0.73
R4503:Zfp938 UTSW 10 82226271 missense possibly damaging 0.73
R4886:Zfp938 UTSW 10 82226123 missense probably benign 0.33
R4934:Zfp938 UTSW 10 82226178 missense possibly damaging 0.86
R5174:Zfp938 UTSW 10 82226004 missense possibly damaging 0.53
R5410:Zfp938 UTSW 10 82225258 missense possibly damaging 0.89
R6491:Zfp938 UTSW 10 82227529 makesense probably null
R6575:Zfp938 UTSW 10 82225326 nonsense probably null
R6649:Zfp938 UTSW 10 82225398 missense probably damaging 0.99
R7992:Zfp938 UTSW 10 82225943 missense possibly damaging 0.53
R8211:Zfp938 UTSW 10 82226585 missense possibly damaging 0.53
R8313:Zfp938 UTSW 10 82225588 missense possibly damaging 0.75
R8963:Zfp938 UTSW 10 82225453 missense possibly damaging 0.61
X0066:Zfp938 UTSW 10 82226097 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GAGTTCTAGTCCTGACTTCCTTTGG -3'
(R):5'- AGTGGGCTTTACTGGATCCTT -3'

Sequencing Primer
(F):5'- ACTTCCTTTGGTGATGAACAGC -3'
(R):5'- TCATGCTGGAAACCTACTGG -3'
Posted On 2018-03-15