Incidental Mutation 'R6284:Akap1'
List |< first << previous [record 4 of 63] next >> last >|
ID508127
Institutional Source Beutler Lab
Gene Symbol Akap1
Ensembl Gene ENSMUSG00000018428
Gene NameA kinase (PRKA) anchor protein 1
SynonymsDAKAP1, AKAP84, S-AKAP84, AKAP121
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001042541.1, NM_009648.2; MGI:104729

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location88830792-88864586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88844568 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 423 (T423A)
Ref Sequence ENSEMBL: ENSMUSP00000122295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018572] [ENSMUST00000107903] [ENSMUST00000107904] [ENSMUST00000143720]
Predicted Effect probably benign
Transcript: ENSMUST00000018572
AA Change: T423A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000018572
Gene: ENSMUSG00000018428
AA Change: T423A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
low complexity region 449 462 N/A INTRINSIC
KH 560 630 1.59e-10 SMART
low complexity region 639 651 N/A INTRINSIC
TUDOR 710 769 5.32e-12 SMART
low complexity region 778 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107903
AA Change: T423A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103536
Gene: ENSMUSG00000018428
AA Change: T423A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
low complexity region 449 462 N/A INTRINSIC
KH 560 630 1.59e-10 SMART
low complexity region 639 651 N/A INTRINSIC
TUDOR 710 769 5.32e-12 SMART
low complexity region 778 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107904
AA Change: T456A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103537
Gene: ENSMUSG00000018428
AA Change: T456A

DomainStartEndE-ValueType
transmembrane domain 40 59 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 482 495 N/A INTRINSIC
KH 593 663 1.59e-10 SMART
low complexity region 672 684 N/A INTRINSIC
TUDOR 743 802 5.32e-12 SMART
low complexity region 811 823 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143720
AA Change: T423A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122295
Gene: ENSMUSG00000018428
AA Change: T423A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:RII_binding_1 305 322 5.5e-5 PFAM
low complexity region 449 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153787
SMART Domains Protein: ENSMUSP00000123018
Gene: ENSMUSG00000018428

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153961
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype Strain: 3620561
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to type I and type II regulatory subunits of PKA and anchors them to the mitochondrion. This protein is speculated to be involved in the cAMP-dependent signal transduction pathway and in directing RNA to a specific cellular compartment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit reduced female fertility and impaired oocyte maturation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(3) Gene trapped(46)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Akap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Akap1 APN 11 88844254 splice site probably null
IGL01333:Akap1 APN 11 88845605 missense probably damaging 0.99
IGL01701:Akap1 APN 11 88845132 missense probably benign 0.03
IGL01920:Akap1 APN 11 88839633 missense probably damaging 1.00
IGL02980:Akap1 UTSW 11 88845164 missense probably benign
PIT4305001:Akap1 UTSW 11 88844378 missense probably benign
R0049:Akap1 UTSW 11 88839624 critical splice donor site probably null
R0049:Akap1 UTSW 11 88839624 critical splice donor site probably null
R0278:Akap1 UTSW 11 88845194 missense probably benign 0.19
R1437:Akap1 UTSW 11 88844751 nonsense probably null
R1438:Akap1 UTSW 11 88844751 nonsense probably null
R1439:Akap1 UTSW 11 88844751 nonsense probably null
R1569:Akap1 UTSW 11 88833180 missense probably benign 0.02
R1611:Akap1 UTSW 11 88845278 missense probably benign 0.27
R1757:Akap1 UTSW 11 88845752 missense probably damaging 1.00
R2328:Akap1 UTSW 11 88845044 missense possibly damaging 0.46
R2897:Akap1 UTSW 11 88844779 nonsense probably null
R3730:Akap1 UTSW 11 88845182 missense possibly damaging 0.82
R4868:Akap1 UTSW 11 88844553 missense possibly damaging 0.83
R5620:Akap1 UTSW 11 88845517 missense possibly damaging 0.82
R5645:Akap1 UTSW 11 88845627 missense probably benign 0.01
R5886:Akap1 UTSW 11 88834660 critical splice donor site probably null
R5932:Akap1 UTSW 11 88831759 missense probably damaging 1.00
R6555:Akap1 UTSW 11 88844882 missense probably damaging 1.00
R7234:Akap1 UTSW 11 88838982 missense probably damaging 1.00
R7436:Akap1 UTSW 11 88845528 missense probably damaging 1.00
R7759:Akap1 UTSW 11 88845833 missense probably damaging 1.00
Z1176:Akap1 UTSW 11 88837167 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGAAGGGCTGAGTACTGACTG -3'
(R):5'- AGACACCTCAGATCCTGCTTC -3'

Sequencing Primer
(F):5'- GTCATAGCTTTGTCTCCGGAGC -3'
(R):5'- TCCTGCTTCCACCAGAACAGG -3'
Posted On2018-03-15