Mutagenetix > Incidental Mutations

Incidental Mutation 'R6284:March11'

508132

Institutional Source

Beutler Lab

Gene Symbol

March11

Ensembl Gene

ENSMUSG00000022269

Gene Name

membrane-associated ring finger (C3HC4) 11

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.231) question?

Stock #

R6284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26309048-26409576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 26409346 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 377 (R377Q)

Ref Sequence

ENSEMBL: ENSMUSP00000118729 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140840] [ENSMUST00000152841]

Predicted Effect

probably benign
Transcript: ENSMUST00000140840
AA Change: R377Q

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000118729
Gene: ENSMUSG00000022269
AA Change: R377Q

Domain	Start	End	E-Value	Type
low complexity region	19	30	N/A	INTRINSIC
low complexity region	73	83	N/A	INTRINSIC
low complexity region	143	165	N/A	INTRINSIC
RINGv	167	214	4.81e-16	SMART
transmembrane domain	244	266	N/A	INTRINSIC
Blast:AAA	269	296	6e-7	BLAST
low complexity region	329	341	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152841

SMART Domains

Protein: ENSMUSP00000120622
Gene: ENSMUSG00000022269

Domain	Start	End	E-Value	Type
low complexity region	19	30	N/A	INTRINSIC
low complexity region	73	83	N/A	INTRINSIC
low complexity region	143	165	N/A	INTRINSIC
RINGv	167	214	4.81e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155819

Meta Mutation Damage Score

0.0697

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH11 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). These enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their intracellular transport. March11 appears to have a role in ubiquitin-mediated protein sorting in the trans-Golgi network (TGN)-multivesicular body (MVB) transport pathway (Morokuma et al., 2007 [PubMed 17604280]).[supplied by OMIM, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	G	T	6: 72,347,454	G16C	probably damaging	Het
Abca7	G	A	10: 80,004,410	V801I	probably benign	Het
Adgrl2	A	T	3: 148,826,507	L1030Q	probably damaging	Het
Akap1	T	C	11: 88,844,568	T423A	possibly damaging	Het
Anpep	T	A	7: 79,825,802	D111V	probably damaging	Het
Atm	T	A	9: 53,445,376		probably null	Het
Atp5a1	T	A	18: 77,778,468	S106T	probably benign	Het
Atp5k	T	C	5: 108,434,059	I20V	probably benign	Het
Atp6v0d2	T	A	4: 19,922,605		probably null	Het
Bclaf1	T	G	10: 20,322,160		probably null	Het
Bod1l	A	G	5: 41,818,787	V1728A	probably benign	Het
Braf	A	G	6: 39,688,282	F51L	possibly damaging	Het
Camsap2	A	G	1: 136,304,437	I140T	possibly damaging	Het
Ccdc24	A	T	4: 117,869,653		probably null	Het
Cdh26	G	C	2: 178,449,884	G79R	probably damaging	Het
Cenpf	A	G	1: 189,652,742	L2447P	probably damaging	Het
Cfap74	T	C	4: 155,451,796	F863L	probably damaging	Het
Clstn2	C	T	9: 97,454,674	G917S	probably benign	Het
Col6a6	A	T	9: 105,727,227		probably null	Het
Cul5	G	A	9: 53,623,735	P596L	probably damaging	Het
Dst	A	T	1: 34,229,085	R2863W	probably damaging	Het
Dthd1	A	G	5: 62,814,041	E69G	possibly damaging	Het
Erich2	T	A	2: 70,539,684	I402N	probably damaging	Het
Fam160a1	G	A	3: 85,672,688	P737S	probably benign	Het
Fam162b	T	C	10: 51,585,502	K155R	probably damaging	Het
Glb1l2	A	T	9: 26,767,448	S466T	probably benign	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gm5724	T	C	6: 141,725,393	D451G	probably damaging	Het
Ikbkap	A	T	4: 56,762,281	I1106K	probably damaging	Het
Kazn	G	A	4: 142,117,197	L402F	probably benign	Het
Kcnj13	A	T	1: 87,386,886	S205T	probably damaging	Het
Lama1	T	A	17: 67,810,096	V2462E	probably damaging	Het
Lce1b	A	C	3: 92,656,104	C41G	unknown	Het
Lyar	T	A	5: 38,225,995	W77R	probably damaging	Het
Mis18bp1	A	G	12: 65,138,787	F869L	probably benign	Het
Myom1	T	A	17: 71,022,892	Y6*	probably null	Het
Myzap	T	C	9: 71,558,925	I150V	probably benign	Het
Nop14	C	T	5: 34,641,491		probably null	Het
Oprl1	T	A	2: 181,717,991		probably benign	Het
Pacsin1	T	C	17: 27,708,504	L432P	probably damaging	Het
Peak1	A	G	9: 56,260,296	L116P	probably benign	Het
Plcb2	C	T	2: 118,717,301	V482M	probably benign	Het
Pnliprp1	T	A	19: 58,734,984	I269N	probably damaging	Het
Pnpla7	C	A	2: 25,016,618	D664E	possibly damaging	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Rps6kb2	G	T	19: 4,161,187	T113K	probably benign	Het
Rrp7a	A	T	15: 83,121,860	I63N	probably damaging	Het
Slc29a1	A	G	17: 45,589,921		probably null	Het
Stxbp5	A	C	10: 9,767,179	S1059A	probably benign	Het
Stxbp5	C	A	10: 9,767,187	G1056V	probably damaging	Het
Taldo1	T	A	7: 141,398,583	S149T	possibly damaging	Het
Tlr1	T	C	5: 64,927,099	D45G	possibly damaging	Het
Tnrc6a	T	C	7: 123,171,335	S783P	probably damaging	Het
Trap1	A	G	16: 4,060,809	Y220H	probably benign	Het
Trpc6	A	G	9: 8,643,600	D462G	possibly damaging	Het
Ttc21a	A	G	9: 119,943,962	E235G	probably damaging	Het
Tubb4a	A	G	17: 57,080,833	Y398H	probably damaging	Het
Ube2z	A	G	11: 96,050,407	F303S	probably damaging	Het
Vmn1r211	A	G	13: 22,852,084	S138P	probably damaging	Het
Zfp93	T	A	7: 24,275,629	C346*	probably null	Het
Zfp938	A	T	10: 82,227,566	S52R	possibly damaging	Het
Zp1	A	T	19: 10,916,503	L446Q	probably damaging	Het

Other mutations in March11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01618:March11	APN	15	26409199	missense	possibly damaging	0.93
IGL03079:March11	APN	15	26311058	missense	probably damaging	1.00
R0625:March11	UTSW	15	26311043	missense	probably damaging	0.99
R1055:March11	UTSW	15	26309662	missense	probably damaging	0.99
R1116:March11	UTSW	15	26409295	missense	probably damaging	1.00
R1851:March11	UTSW	15	26387830	missense	probably damaging	1.00
R3862:March11	UTSW	15	26387866	missense	probably damaging	1.00
R3863:March11	UTSW	15	26387866	missense	probably damaging	1.00
R3864:March11	UTSW	15	26387866	missense	probably damaging	1.00
R4373:March11	UTSW	15	26309446	missense	probably damaging	0.96
R4375:March11	UTSW	15	26309446	missense	probably damaging	0.96
R4376:March11	UTSW	15	26309446	missense	probably damaging	0.96
R4580:March11	UTSW	15	26311103	missense	probably damaging	1.00
R6710:March11	UTSW	15	26387863	missense	probably damaging	1.00
R7490:March11	UTSW	15	26311101	missense	possibly damaging	0.88
R7748:March11	UTSW	15	26387830	missense	probably damaging	0.98
R7794:March11	UTSW	15	26409198	missense	probably benign	0.09
R7937:March11	UTSW	15	26409237	missense	probably damaging	0.99
R7942:March11	UTSW	15	26409419	makesense	probably null
X0063:March11	UTSW	15	26387893	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTGCCGTTTACAGAGTG -3'
(R):5'- TCGTGGATGTACAGTTAGAAGTGC -3'

Sequencing Primer
(F):5'- CTGCCGTTTACAGAGTGTTTAAGC -3'
(R):5'- ACAGTTAGAAGTGCTATGGTTTTGCC -3'

Posted On

2018-03-15