Incidental Mutation 'R6284:Rrp7a'
List |< first << previous [record 48 of 63] next >> last >|
ID508133
Institutional Source Beutler Lab
Gene Symbol Rrp7a
Ensembl Gene ENSMUSG00000018040
Gene Nameribosomal RNA processing 7 homolog A (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location83113433-83122801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83121860 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 63 (I63N)
Ref Sequence ENSEMBL: ENSMUSP00000128380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018184] [ENSMUST00000058793] [ENSMUST00000100375] [ENSMUST00000166019] [ENSMUST00000167483]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018184
AA Change: I63N

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018184
Gene: ENSMUSG00000018040
AA Change: I63N

DomainStartEndE-ValueType
SCOP:d1l3ka1 56 140 2e-6 SMART
Pfam:RRP7 151 280 8.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058793
SMART Domains Protein: ENSMUSP00000054548
Gene: ENSMUSG00000041815

DomainStartEndE-ValueType
low complexity region 183 196 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
RRM 281 347 5.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100375
SMART Domains Protein: ENSMUSP00000097944
Gene: ENSMUSG00000041815

DomainStartEndE-ValueType
low complexity region 154 167 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
RRM 252 318 5.05e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166019
AA Change: I78N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129142
Gene: ENSMUSG00000018040
AA Change: I78N

DomainStartEndE-ValueType
SCOP:d1l3ka1 71 144 4e-5 SMART
Blast:RRM 75 145 1e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166766
SMART Domains Protein: ENSMUSP00000127001
Gene: ENSMUSG00000018040

DomainStartEndE-ValueType
Pfam:RRP7 1 51 8.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167483
AA Change: I63N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128380
Gene: ENSMUSG00000018040
AA Change: I63N

DomainStartEndE-ValueType
SCOP:d1l3ka1 56 90 6e-5 SMART
Blast:RRM 60 114 1e-25 BLAST
low complexity region 122 143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167589
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Rrp7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Rrp7a APN 15 83118081 missense probably benign 0.34
IGL02335:Rrp7a APN 15 83122691 missense probably benign 0.00
IGL02524:Rrp7a APN 15 83118178 unclassified probably benign
R4944:Rrp7a UTSW 15 83119809 unclassified probably benign
R7284:Rrp7a UTSW 15 83121870 missense probably damaging 0.96
R7548:Rrp7a UTSW 15 83117670 missense possibly damaging 0.85
R8018:Rrp7a UTSW 15 83116924 missense possibly damaging 0.49
Z1177:Rrp7a UTSW 15 83122138 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTCTAGAAAGAACTGCAGTGATTAC -3'
(R):5'- ACACAGACCTCCTTTCAGGGTAC -3'

Sequencing Primer
(F):5'- CTGAGCCTCAGGAAGTTCTGAAC -3'
(R):5'- GGTACCCCAAACTCTCCTGCG -3'
Posted On2018-03-15