Mutagenetix > Incidental Mutations

Incidental Mutation 'R6284:Trap1'

508134

Institutional Source

Beutler Lab

Gene Symbol

Trap1

Ensembl Gene

ENSMUSG00000005981

Gene Name

TNF receptor-associated protein 1

Synonyms

HSP75, 2410002K23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4039971-4077827 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4060809 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 220 (Y220H)

Ref Sequence

ENSEMBL: ENSMUSP00000006137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006137]

Predicted Effect

probably benign
Transcript: ENSMUST00000006137
AA Change: Y220H

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000006137
Gene: ENSMUSG00000005981
AA Change: Y220H

Domain	Start	End	E-Value	Type
HATPase_c	110	263	3.68e-3	SMART
Pfam:HSP90	290	706	2.6e-98	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138594

Predicted Effect

probably benign
Transcript: ENSMUST00000150354

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175521

Meta Mutation Damage Score

0.1631

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial chaperone protein that is member of the heat shock protein 90 (HSP90) family. The encoded protein has ATPase activity and interacts with tumor necrosis factor type I. This protein may function in regulating cellular stress responses. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced body weight; liver and spleen hyperplasia; decreased chronic inflammation and tumor incidents; deregulated mitochondrial respiration; and increased oxidative stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	G	T	6: 72,347,454	G16C	probably damaging	Het
Abca7	G	A	10: 80,004,410	V801I	probably benign	Het
Adgrl2	A	T	3: 148,826,507	L1030Q	probably damaging	Het
Akap1	T	C	11: 88,844,568	T423A	possibly damaging	Het
Anpep	T	A	7: 79,825,802	D111V	probably damaging	Het
Atm	T	A	9: 53,445,376		probably null	Het
Atp5a1	T	A	18: 77,778,468	S106T	probably benign	Het
Atp5k	T	C	5: 108,434,059	I20V	probably benign	Het
Atp6v0d2	T	A	4: 19,922,605		probably null	Het
Bclaf1	T	G	10: 20,322,160		probably null	Het
Bod1l	A	G	5: 41,818,787	V1728A	probably benign	Het
Braf	A	G	6: 39,688,282	F51L	possibly damaging	Het
Camsap2	A	G	1: 136,304,437	I140T	possibly damaging	Het
Ccdc24	A	T	4: 117,869,653		probably null	Het
Cdh26	G	C	2: 178,449,884	G79R	probably damaging	Het
Cenpf	A	G	1: 189,652,742	L2447P	probably damaging	Het
Cfap74	T	C	4: 155,451,796	F863L	probably damaging	Het
Clstn2	C	T	9: 97,454,674	G917S	probably benign	Het
Col6a6	A	T	9: 105,727,227		probably null	Het
Cul5	G	A	9: 53,623,735	P596L	probably damaging	Het
Dst	A	T	1: 34,229,085	R2863W	probably damaging	Het
Dthd1	A	G	5: 62,814,041	E69G	possibly damaging	Het
Erich2	T	A	2: 70,539,684	I402N	probably damaging	Het
Fam160a1	G	A	3: 85,672,688	P737S	probably benign	Het
Fam162b	T	C	10: 51,585,502	K155R	probably damaging	Het
Glb1l2	A	T	9: 26,767,448	S466T	probably benign	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gm5724	T	C	6: 141,725,393	D451G	probably damaging	Het
Ikbkap	A	T	4: 56,762,281	I1106K	probably damaging	Het
Kazn	G	A	4: 142,117,197	L402F	probably benign	Het
Kcnj13	A	T	1: 87,386,886	S205T	probably damaging	Het
Lama1	T	A	17: 67,810,096	V2462E	probably damaging	Het
Lce1b	A	C	3: 92,656,104	C41G	unknown	Het
Lyar	T	A	5: 38,225,995	W77R	probably damaging	Het
March11	G	A	15: 26,409,346	R377Q	probably benign	Het
Mis18bp1	A	G	12: 65,138,787	F869L	probably benign	Het
Myom1	T	A	17: 71,022,892	Y6*	probably null	Het
Myzap	T	C	9: 71,558,925	I150V	probably benign	Het
Nop14	C	T	5: 34,641,491		probably null	Het
Oprl1	T	A	2: 181,717,991		probably benign	Het
Pacsin1	T	C	17: 27,708,504	L432P	probably damaging	Het
Peak1	A	G	9: 56,260,296	L116P	probably benign	Het
Plcb2	C	T	2: 118,717,301	V482M	probably benign	Het
Pnliprp1	T	A	19: 58,734,984	I269N	probably damaging	Het
Pnpla7	C	A	2: 25,016,618	D664E	possibly damaging	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Rps6kb2	G	T	19: 4,161,187	T113K	probably benign	Het
Rrp7a	A	T	15: 83,121,860	I63N	probably damaging	Het
Slc29a1	A	G	17: 45,589,921		probably null	Het
Stxbp5	A	C	10: 9,767,179	S1059A	probably benign	Het
Stxbp5	C	A	10: 9,767,187	G1056V	probably damaging	Het
Taldo1	T	A	7: 141,398,583	S149T	possibly damaging	Het
Tlr1	T	C	5: 64,927,099	D45G	possibly damaging	Het
Tnrc6a	T	C	7: 123,171,335	S783P	probably damaging	Het
Trpc6	A	G	9: 8,643,600	D462G	possibly damaging	Het
Ttc21a	A	G	9: 119,943,962	E235G	probably damaging	Het
Tubb4a	A	G	17: 57,080,833	Y398H	probably damaging	Het
Ube2z	A	G	11: 96,050,407	F303S	probably damaging	Het
Vmn1r211	A	G	13: 22,852,084	S138P	probably damaging	Het
Zfp93	T	A	7: 24,275,629	C346*	probably null	Het
Zfp938	A	T	10: 82,227,566	S52R	possibly damaging	Het
Zp1	A	T	19: 10,916,503	L446Q	probably damaging	Het

Other mutations in Trap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01155:Trap1	APN	16	4043978	nonsense	probably null
IGL03087:Trap1	APN	16	4044701	splice site	probably null
E0354:Trap1	UTSW	16	4065288	missense	probably benign	0.01
R0034:Trap1	UTSW	16	4069030	splice site	probably benign
R0034:Trap1	UTSW	16	4069030	splice site	probably benign
R0316:Trap1	UTSW	16	4045560	missense	probably benign
R0336:Trap1	UTSW	16	4044626	missense	probably damaging	0.99
R0614:Trap1	UTSW	16	4060751	splice site	probably benign
R2069:Trap1	UTSW	16	4068336	missense	probably benign
R2089:Trap1	UTSW	16	4046039	nonsense	probably null
R2091:Trap1	UTSW	16	4046039	nonsense	probably null
R2091:Trap1	UTSW	16	4046039	nonsense	probably null
R2148:Trap1	UTSW	16	4060760	missense	probably damaging	0.97
R2419:Trap1	UTSW	16	4068330	missense	probably benign	0.23
R3853:Trap1	UTSW	16	4054822	missense	possibly damaging	0.69
R4926:Trap1	UTSW	16	4045488	missense	probably benign	0.27
R5120:Trap1	UTSW	16	4044088	missense	probably damaging	1.00
R5261:Trap1	UTSW	16	4056422	missense	probably damaging	1.00
R5434:Trap1	UTSW	16	4044665	missense	probably benign	0.00
R6194:Trap1	UTSW	16	4054800	missense	possibly damaging	0.94
R6415:Trap1	UTSW	16	4043992	missense	possibly damaging	0.92
R7132:Trap1	UTSW	16	4055829	missense	probably benign	0.17
R7167:Trap1	UTSW	16	4052928	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTACAACAGCATCTTAAGGAACTCC -3'
(R):5'- ATATGCTAGAGGACCCTGCC -3'

Sequencing Primer
(F):5'- ATGGTGCACATCTGAGATCC -3'
(R):5'- CCAGCACAACACAGGTGGG -3'

Posted On

2018-03-15