Incidental Mutation 'R6284:Trap1'
List |< first << previous [record 55 of 63] next >> last >|
ID508134
Institutional Source Beutler Lab
Gene Symbol Trap1
Ensembl Gene ENSMUSG00000005981
Gene NameTNF receptor-associated protein 1
SynonymsHSP75, 2410002K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location4039971-4077827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4060809 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 220 (Y220H)
Ref Sequence ENSEMBL: ENSMUSP00000006137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006137]
Predicted Effect probably benign
Transcript: ENSMUST00000006137
AA Change: Y220H

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000006137
Gene: ENSMUSG00000005981
AA Change: Y220H

DomainStartEndE-ValueType
HATPase_c 110 263 3.68e-3 SMART
Pfam:HSP90 290 706 2.6e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138594
Predicted Effect probably benign
Transcript: ENSMUST00000150354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175521
Meta Mutation Damage Score 0.1631 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial chaperone protein that is member of the heat shock protein 90 (HSP90) family. The encoded protein has ATPase activity and interacts with tumor necrosis factor type I. This protein may function in regulating cellular stress responses. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced body weight; liver and spleen hyperplasia; decreased chronic inflammation and tumor incidents; deregulated mitochondrial respiration; and increased oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Trap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Trap1 APN 16 4043978 nonsense probably null
IGL03087:Trap1 APN 16 4044701 splice site probably null
E0354:Trap1 UTSW 16 4065288 missense probably benign 0.01
R0034:Trap1 UTSW 16 4069030 splice site probably benign
R0034:Trap1 UTSW 16 4069030 splice site probably benign
R0316:Trap1 UTSW 16 4045560 missense probably benign
R0336:Trap1 UTSW 16 4044626 missense probably damaging 0.99
R0614:Trap1 UTSW 16 4060751 splice site probably benign
R2069:Trap1 UTSW 16 4068336 missense probably benign
R2089:Trap1 UTSW 16 4046039 nonsense probably null
R2091:Trap1 UTSW 16 4046039 nonsense probably null
R2091:Trap1 UTSW 16 4046039 nonsense probably null
R2148:Trap1 UTSW 16 4060760 missense probably damaging 0.97
R2419:Trap1 UTSW 16 4068330 missense probably benign 0.23
R3853:Trap1 UTSW 16 4054822 missense possibly damaging 0.69
R4926:Trap1 UTSW 16 4045488 missense probably benign 0.27
R5120:Trap1 UTSW 16 4044088 missense probably damaging 1.00
R5261:Trap1 UTSW 16 4056422 missense probably damaging 1.00
R5434:Trap1 UTSW 16 4044665 missense probably benign 0.00
R6194:Trap1 UTSW 16 4054800 missense possibly damaging 0.94
R6415:Trap1 UTSW 16 4043992 missense possibly damaging 0.92
R7132:Trap1 UTSW 16 4055829 missense probably benign 0.17
R7167:Trap1 UTSW 16 4052928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACAACAGCATCTTAAGGAACTCC -3'
(R):5'- ATATGCTAGAGGACCCTGCC -3'

Sequencing Primer
(F):5'- ATGGTGCACATCTGAGATCC -3'
(R):5'- CCAGCACAACACAGGTGGG -3'
Posted On2018-03-15