Incidental Mutation 'R6284:Pacsin1'
ID508135
Institutional Source Beutler Lab
Gene Symbol Pacsin1
Ensembl Gene ENSMUSG00000040276
Gene Nameprotein kinase C and casein kinase substrate in neurons 1
SynonymsA830061D09Rik, Syndapin I
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location27655509-27711482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27708504 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 432 (L432P)
Ref Sequence ENSEMBL: ENSMUSP00000155999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045896] [ENSMUST00000097360] [ENSMUST00000114872] [ENSMUST00000114873] [ENSMUST00000231236] [ENSMUST00000231669] [ENSMUST00000232437]
Predicted Effect probably damaging
Transcript: ENSMUST00000045896
AA Change: L432P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044168
Gene: ENSMUSG00000040276
AA Change: L432P

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097360
AA Change: L432P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094973
Gene: ENSMUSG00000040276
AA Change: L432P

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114872
AA Change: S274P
SMART Domains Protein: ENSMUSP00000110522
Gene: ENSMUSG00000040276
AA Change: S274P

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114873
AA Change: L432P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110523
Gene: ENSMUSG00000040276
AA Change: L432P

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231350
Predicted Effect probably damaging
Transcript: ENSMUST00000231669
AA Change: L432P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232225
Predicted Effect probably damaging
Transcript: ENSMUST00000232437
AA Change: L432P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygotes for a gene trapped allele show altered type I interferon responses in plasmacytoid dendritic cells. Homozygotes for a null allele show impaired synaptic vesicle formation, synaptic transmission and neuronal network activity, and develop generalized seizures with tonic-clonic convulsions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Pacsin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Pacsin1 APN 17 27704835 splice site probably null
IGL02752:Pacsin1 APN 17 27702698 critical splice acceptor site probably null
R1428:Pacsin1 UTSW 17 27705963 missense probably damaging 1.00
R2332:Pacsin1 UTSW 17 27704911 missense possibly damaging 0.73
R4349:Pacsin1 UTSW 17 27707004 missense possibly damaging 0.52
R4664:Pacsin1 UTSW 17 27707064 missense probably damaging 1.00
R5568:Pacsin1 UTSW 17 27708048 missense probably damaging 1.00
R5936:Pacsin1 UTSW 17 27704997 missense probably benign 0.16
R5943:Pacsin1 UTSW 17 27706071 missense probably damaging 1.00
R6277:Pacsin1 UTSW 17 27705995 unclassified probably null
R6376:Pacsin1 UTSW 17 27707905 missense probably benign 0.33
R7134:Pacsin1 UTSW 17 27702733 missense probably damaging 1.00
R8141:Pacsin1 UTSW 17 27707060 missense possibly damaging 0.78
Z1177:Pacsin1 UTSW 17 27708438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGAAGGCCTGTGGTTAG -3'
(R):5'- CTGCAAACGCTGTCTCTTCG -3'

Sequencing Primer
(F):5'- AAGGCCTGTGGTTAGCATTTG -3'
(R):5'- TGGAACTCTATGGCAAGG -3'
Posted On2018-03-15