Mutagenetix > Incidental Mutations

Incidental Mutation 'R6284:Tubb4a'

508137

Institutional Source

Beutler Lab

Gene Symbol

Tubb4a

Ensembl Gene

ENSMUSG00000062591

Gene Name

tubulin, beta 4A class IVA

Synonyms

Tubb, Tubb4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57080066-57087782 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57080833 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 398 (Y398H)

Ref Sequence

ENSEMBL: ENSMUSP00000071135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011623] [ENSMUST00000071135]

Predicted Effect

probably benign
Transcript: ENSMUST00000011623

SMART Domains

Protein: ENSMUSP00000011623
Gene: ENSMUSG00000002668

Domain	Start	End	E-Value	Type
uDENN	9	89	1.18e-22	SMART
DENN	90	293	3.95e-74	SMART
low complexity region	312	318	N/A	INTRINSIC
dDENN	324	391	2.39e-18	SMART
low complexity region	560	579	N/A	INTRINSIC
low complexity region	657	675	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000071135
AA Change: Y398H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071135
Gene: ENSMUSG00000062591
AA Change: Y398H

Domain	Start	End	E-Value	Type
Tubulin	47	244	4.45e-67	SMART
Tubulin_C	246	383	5.5e-49	SMART
low complexity region	428	444	N/A	INTRINSIC

Meta Mutation Damage Score

0.8917

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta tubulin family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. Mutations in this gene cause hypomyelinating leukodystrophy-6 and autosomal dominant torsion dystonia-4. Alternate splicing results in multiple transcript variants encoding different isoforms. A pseudogene of this gene is found on chromosome X. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	G	T	6: 72,347,454	G16C	probably damaging	Het
Abca7	G	A	10: 80,004,410	V801I	probably benign	Het
Adgrl2	A	T	3: 148,826,507	L1030Q	probably damaging	Het
Akap1	T	C	11: 88,844,568	T423A	possibly damaging	Het
Anpep	T	A	7: 79,825,802	D111V	probably damaging	Het
Atm	T	A	9: 53,445,376		probably null	Het
Atp5a1	T	A	18: 77,778,468	S106T	probably benign	Het
Atp5k	T	C	5: 108,434,059	I20V	probably benign	Het
Atp6v0d2	T	A	4: 19,922,605		probably null	Het
Bclaf1	T	G	10: 20,322,160		probably null	Het
Bod1l	A	G	5: 41,818,787	V1728A	probably benign	Het
Braf	A	G	6: 39,688,282	F51L	possibly damaging	Het
Camsap2	A	G	1: 136,304,437	I140T	possibly damaging	Het
Ccdc24	A	T	4: 117,869,653		probably null	Het
Cdh26	G	C	2: 178,449,884	G79R	probably damaging	Het
Cenpf	A	G	1: 189,652,742	L2447P	probably damaging	Het
Cfap74	T	C	4: 155,451,796	F863L	probably damaging	Het
Clstn2	C	T	9: 97,454,674	G917S	probably benign	Het
Col6a6	A	T	9: 105,727,227		probably null	Het
Cul5	G	A	9: 53,623,735	P596L	probably damaging	Het
Dst	A	T	1: 34,229,085	R2863W	probably damaging	Het
Dthd1	A	G	5: 62,814,041	E69G	possibly damaging	Het
Erich2	T	A	2: 70,539,684	I402N	probably damaging	Het
Fam160a1	G	A	3: 85,672,688	P737S	probably benign	Het
Fam162b	T	C	10: 51,585,502	K155R	probably damaging	Het
Glb1l2	A	T	9: 26,767,448	S466T	probably benign	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gm5724	T	C	6: 141,725,393	D451G	probably damaging	Het
Ikbkap	A	T	4: 56,762,281	I1106K	probably damaging	Het
Kazn	G	A	4: 142,117,197	L402F	probably benign	Het
Kcnj13	A	T	1: 87,386,886	S205T	probably damaging	Het
Lama1	T	A	17: 67,810,096	V2462E	probably damaging	Het
Lce1b	A	C	3: 92,656,104	C41G	unknown	Het
Lyar	T	A	5: 38,225,995	W77R	probably damaging	Het
March11	G	A	15: 26,409,346	R377Q	probably benign	Het
Mis18bp1	A	G	12: 65,138,787	F869L	probably benign	Het
Myom1	T	A	17: 71,022,892	Y6*	probably null	Het
Myzap	T	C	9: 71,558,925	I150V	probably benign	Het
Nop14	C	T	5: 34,641,491		probably null	Het
Oprl1	T	A	2: 181,717,991		probably benign	Het
Pacsin1	T	C	17: 27,708,504	L432P	probably damaging	Het
Peak1	A	G	9: 56,260,296	L116P	probably benign	Het
Plcb2	C	T	2: 118,717,301	V482M	probably benign	Het
Pnliprp1	T	A	19: 58,734,984	I269N	probably damaging	Het
Pnpla7	C	A	2: 25,016,618	D664E	possibly damaging	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Rps6kb2	G	T	19: 4,161,187	T113K	probably benign	Het
Rrp7a	A	T	15: 83,121,860	I63N	probably damaging	Het
Slc29a1	A	G	17: 45,589,921		probably null	Het
Stxbp5	A	C	10: 9,767,179	S1059A	probably benign	Het
Stxbp5	C	A	10: 9,767,187	G1056V	probably damaging	Het
Taldo1	T	A	7: 141,398,583	S149T	possibly damaging	Het
Tlr1	T	C	5: 64,927,099	D45G	possibly damaging	Het
Tnrc6a	T	C	7: 123,171,335	S783P	probably damaging	Het
Trap1	A	G	16: 4,060,809	Y220H	probably benign	Het
Trpc6	A	G	9: 8,643,600	D462G	possibly damaging	Het
Ttc21a	A	G	9: 119,943,962	E235G	probably damaging	Het
Ube2z	A	G	11: 96,050,407	F303S	probably damaging	Het
Vmn1r211	A	G	13: 22,852,084	S138P	probably damaging	Het
Zfp93	T	A	7: 24,275,629	C346*	probably null	Het
Zfp938	A	T	10: 82,227,566	S52R	possibly damaging	Het
Zp1	A	T	19: 10,916,503	L446Q	probably damaging	Het

Other mutations in Tubb4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00956:Tubb4a	APN	17	57086072	missense	probably benign	0.24
IGL02343:Tubb4a	APN	17	57081538	missense	probably benign
IGL02562:Tubb4a	APN	17	57081163	nonsense	probably null
P0022:Tubb4a	UTSW	17	57081538	missense	probably benign
R0043:Tubb4a	UTSW	17	57081114	missense	probably damaging	1.00
R0195:Tubb4a	UTSW	17	57081499	missense	probably damaging	1.00
R0309:Tubb4a	UTSW	17	57081182	nonsense	probably null
R0348:Tubb4a	UTSW	17	57080770	missense	probably damaging	0.98
R2440:Tubb4a	UTSW	17	57086285	missense	probably damaging	1.00
R2762:Tubb4a	UTSW	17	57080974	missense	probably benign
R3927:Tubb4a	UTSW	17	57080967	missense	probably benign	0.00
R6351:Tubb4a	UTSW	17	57081016	missense	probably damaging	1.00
R6760:Tubb4a	UTSW	17	57080796	missense	possibly damaging	0.82
R6822:Tubb4a	UTSW	17	57080904	missense	probably damaging	0.99
R7381:Tubb4a	UTSW	17	57080698	missense	unknown
R7507:Tubb4a	UTSW	17	57081642	missense	probably damaging	1.00
R7892:Tubb4a	UTSW	17	57080880	nonsense	probably null
R7975:Tubb4a	UTSW	17	57080880	nonsense	probably null
RF013:Tubb4a	UTSW	17	57087464	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCAAAGCTTTGCTGGTGGGC -3'
(R):5'- GACGAGCAGATGTTAAGTGTGC -3'

Sequencing Primer
(F):5'- CCCCAGGGACAGAGTGATG -3'
(R):5'- GCAAGAACAGCAGTTACTTCGTTG -3'

Posted On

2018-03-15