Incidental Mutation 'R6284:Tubb4a'
List |< first << previous [record 58 of 63] next >> last >|
ID508137
Institutional Source Beutler Lab
Gene Symbol Tubb4a
Ensembl Gene ENSMUSG00000062591
Gene Nametubulin, beta 4A class IVA
SynonymsTubb, Tubb4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57080066-57087782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57080833 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 398 (Y398H)
Ref Sequence ENSEMBL: ENSMUSP00000071135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011623] [ENSMUST00000071135]
Predicted Effect probably benign
Transcript: ENSMUST00000011623
SMART Domains Protein: ENSMUSP00000011623
Gene: ENSMUSG00000002668

DomainStartEndE-ValueType
uDENN 9 89 1.18e-22 SMART
DENN 90 293 3.95e-74 SMART
low complexity region 312 318 N/A INTRINSIC
dDENN 324 391 2.39e-18 SMART
low complexity region 560 579 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071135
AA Change: Y398H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071135
Gene: ENSMUSG00000062591
AA Change: Y398H

DomainStartEndE-ValueType
Tubulin 47 244 4.45e-67 SMART
Tubulin_C 246 383 5.5e-49 SMART
low complexity region 428 444 N/A INTRINSIC
Meta Mutation Damage Score 0.8917 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta tubulin family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. Mutations in this gene cause hypomyelinating leukodystrophy-6 and autosomal dominant torsion dystonia-4. Alternate splicing results in multiple transcript variants encoding different isoforms. A pseudogene of this gene is found on chromosome X. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Tubb4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Tubb4a APN 17 57086072 missense probably benign 0.24
IGL02343:Tubb4a APN 17 57081538 missense probably benign
IGL02562:Tubb4a APN 17 57081163 nonsense probably null
P0022:Tubb4a UTSW 17 57081538 missense probably benign
R0043:Tubb4a UTSW 17 57081114 missense probably damaging 1.00
R0195:Tubb4a UTSW 17 57081499 missense probably damaging 1.00
R0309:Tubb4a UTSW 17 57081182 nonsense probably null
R0348:Tubb4a UTSW 17 57080770 missense probably damaging 0.98
R2440:Tubb4a UTSW 17 57086285 missense probably damaging 1.00
R2762:Tubb4a UTSW 17 57080974 missense probably benign
R3927:Tubb4a UTSW 17 57080967 missense probably benign 0.00
R6351:Tubb4a UTSW 17 57081016 missense probably damaging 1.00
R6760:Tubb4a UTSW 17 57080796 missense possibly damaging 0.82
R6822:Tubb4a UTSW 17 57080904 missense probably damaging 0.99
R7381:Tubb4a UTSW 17 57080698 missense unknown
R7507:Tubb4a UTSW 17 57081642 missense probably damaging 1.00
R7892:Tubb4a UTSW 17 57080880 nonsense probably null
RF013:Tubb4a UTSW 17 57087464 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAAAGCTTTGCTGGTGGGC -3'
(R):5'- GACGAGCAGATGTTAAGTGTGC -3'

Sequencing Primer
(F):5'- CCCCAGGGACAGAGTGATG -3'
(R):5'- GCAAGAACAGCAGTTACTTCGTTG -3'
Posted On2018-03-15