Mutagenetix > Incidental Mutation

Incidental Mutation 'R6284:Myom1'

508139

Institutional Source

Beutler Lab

Gene Symbol

Myom1

Ensembl Gene

ENSMUSG00000024049

Gene Name

myomesin 1

Synonyms

skelemin, D430047A17Rik

MMRRC Submission

044454-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71019521-71126856 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 71022892 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 6 (Y6*)

Ref Sequence

ENSEMBL: ENSMUSP00000136266 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]

AlphaFold

Q62234

Predicted Effect

probably null
Transcript: ENSMUST00000024847
AA Change: Y6*

SMART Domains

Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: Y6*

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000073211
AA Change: Y6*

SMART Domains

Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: Y6*

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
low complexity region	857	870	N/A	INTRINSIC
FN3	916	1002	4.99e-11	SMART
FN3	1021	1106	2.04e-16	SMART
IG	1123	1208	3.1e0	SMART
IG_like	1231	1317	1.34e1	SMART
IG_like	1351	1417	4.79e0	SMART
IG_like	1454	1531	1.54e2	SMART
IGc2	1567	1635	2.05e-9	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000179759
AA Change: Y6*

SMART Domains

Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: Y6*

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180743

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	G	T	6: 72,347,454	G16C	probably damaging	Het
Abca7	G	A	10: 80,004,410	V801I	probably benign	Het
Adgrl2	A	T	3: 148,826,507	L1030Q	probably damaging	Het
Akap1	T	C	11: 88,844,568	T423A	possibly damaging	Het
Anpep	T	A	7: 79,825,802	D111V	probably damaging	Het
Atm	T	A	9: 53,445,376		probably null	Het
Atp5a1	T	A	18: 77,778,468	S106T	probably benign	Het
Atp5k	T	C	5: 108,434,059	I20V	probably benign	Het
Atp6v0d2	T	A	4: 19,922,605		probably null	Het
Bclaf1	T	G	10: 20,322,160		probably null	Het
Bod1l	A	G	5: 41,818,787	V1728A	probably benign	Het
Braf	A	G	6: 39,688,282	F51L	possibly damaging	Het
Camsap2	A	G	1: 136,304,437	I140T	possibly damaging	Het
Ccdc24	A	T	4: 117,869,653		probably null	Het
Cdh26	G	C	2: 178,449,884	G79R	probably damaging	Het
Cenpf	A	G	1: 189,652,742	L2447P	probably damaging	Het
Cfap74	T	C	4: 155,451,796	F863L	probably damaging	Het
Clstn2	C	T	9: 97,454,674	G917S	probably benign	Het
Col6a6	A	T	9: 105,727,227		probably null	Het
Cul5	G	A	9: 53,623,735	P596L	probably damaging	Het
Dst	A	T	1: 34,229,085	R2863W	probably damaging	Het
Dthd1	A	G	5: 62,814,041	E69G	possibly damaging	Het
Erich2	T	A	2: 70,539,684	I402N	probably damaging	Het
Fam160a1	G	A	3: 85,672,688	P737S	probably benign	Het
Fam162b	T	C	10: 51,585,502	K155R	probably damaging	Het
Glb1l2	A	T	9: 26,767,448	S466T	probably benign	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gm5724	T	C	6: 141,725,393	D451G	probably damaging	Het
Ikbkap	A	T	4: 56,762,281	I1106K	probably damaging	Het
Kazn	G	A	4: 142,117,197	L402F	probably benign	Het
Kcnj13	A	T	1: 87,386,886	S205T	probably damaging	Het
Lama1	T	A	17: 67,810,096	V2462E	probably damaging	Het
Lce1b	A	C	3: 92,656,104	C41G	unknown	Het
Lyar	T	A	5: 38,225,995	W77R	probably damaging	Het
March11	G	A	15: 26,409,346	R377Q	probably benign	Het
Mis18bp1	A	G	12: 65,138,787	F869L	probably benign	Het
Myzap	T	C	9: 71,558,925	I150V	probably benign	Het
Nop14	C	T	5: 34,641,491		probably null	Het
Oprl1	T	A	2: 181,717,991		probably benign	Het
Pacsin1	T	C	17: 27,708,504	L432P	probably damaging	Het
Peak1	A	G	9: 56,260,296	L116P	probably benign	Het
Plcb2	C	T	2: 118,717,301	V482M	probably benign	Het
Pnliprp1	T	A	19: 58,734,984	I269N	probably damaging	Het
Pnpla7	C	A	2: 25,016,618	D664E	possibly damaging	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Rps6kb2	G	T	19: 4,161,187	T113K	probably benign	Het
Rrp7a	A	T	15: 83,121,860	I63N	probably damaging	Het
Slc29a1	A	G	17: 45,589,921		probably null	Het
Stxbp5	A	C	10: 9,767,179	S1059A	probably benign	Het
Stxbp5	C	A	10: 9,767,187	G1056V	probably damaging	Het
Taldo1	T	A	7: 141,398,583	S149T	possibly damaging	Het
Tlr1	T	C	5: 64,927,099	D45G	possibly damaging	Het
Tnrc6a	T	C	7: 123,171,335	S783P	probably damaging	Het
Trap1	A	G	16: 4,060,809	Y220H	probably benign	Het
Trpc6	A	G	9: 8,643,600	D462G	possibly damaging	Het
Ttc21a	A	G	9: 119,943,962	E235G	probably damaging	Het
Tubb4a	A	G	17: 57,080,833	Y398H	probably damaging	Het
Ube2z	A	G	11: 96,050,407	F303S	probably damaging	Het
Vmn1r211	A	G	13: 22,852,084	S138P	probably damaging	Het
Zfp93	T	A	7: 24,275,629	C346*	probably null	Het
Zfp938	A	T	10: 82,227,566	S52R	possibly damaging	Het
Zp1	A	T	19: 10,916,503	L446Q	probably damaging	Het

Other mutations in Myom1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Myom1	APN	17	71126098	missense	probably damaging	1.00
IGL00845:Myom1	APN	17	71084429	missense	probably damaging	1.00
IGL00904:Myom1	APN	17	71099949	splice site	probably benign
IGL00928:Myom1	APN	17	71089913	missense	probably damaging	1.00
IGL01025:Myom1	APN	17	71077917	missense	probably damaging	1.00
IGL01548:Myom1	APN	17	71101220	splice site	probably benign
IGL01588:Myom1	APN	17	71117437	missense	possibly damaging	0.94
IGL01614:Myom1	APN	17	71126178	missense	possibly damaging	0.46
IGL01618:Myom1	APN	17	71099993	missense	possibly damaging	0.87
IGL01619:Myom1	APN	17	71044476	splice site	probably benign
IGL01766:Myom1	APN	17	71077288	missense	probably damaging	1.00
IGL02105:Myom1	APN	17	71047716	splice site	probably benign
IGL02122:Myom1	APN	17	71092137	missense	probably damaging	1.00
IGL02184:Myom1	APN	17	71072137	missense	possibly damaging	0.93
IGL02260:Myom1	APN	17	71108315	nonsense	probably null
IGL02486:Myom1	APN	17	71099944	splice site	probably benign
IGL02501:Myom1	APN	17	71072081	critical splice acceptor site	probably null
IGL02642:Myom1	APN	17	71101098	missense	possibly damaging	0.90
IGL02677:Myom1	APN	17	71084349	missense	probably damaging	1.00
IGL02719:Myom1	APN	17	71106354	splice site	probably benign
IGL02945:Myom1	APN	17	71092093	splice site	probably benign
IGL03086:Myom1	APN	17	71108671	missense	probably damaging	1.00
IGL03218:Myom1	APN	17	71084316	missense	possibly damaging	0.46
R0107:Myom1	UTSW	17	71077365	missense	probably damaging	1.00
R0130:Myom1	UTSW	17	71045755	missense	probably damaging	0.98
R0133:Myom1	UTSW	17	71047787	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0352:Myom1	UTSW	17	71045749	missense	possibly damaging	0.72
R0396:Myom1	UTSW	17	71034693	missense	probably damaging	1.00
R0496:Myom1	UTSW	17	71084306	missense	probably damaging	1.00
R0506:Myom1	UTSW	17	71092220	splice site	probably benign
R0511:Myom1	UTSW	17	71084317	missense	probably benign	0.22
R0600:Myom1	UTSW	17	71120648	missense	possibly damaging	0.48
R0699:Myom1	UTSW	17	71067313	missense	probably damaging	0.98
R0791:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0792:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0963:Myom1	UTSW	17	71077767	missense	possibly damaging	0.74
R1324:Myom1	UTSW	17	71052719	missense	probably damaging	0.98
R2102:Myom1	UTSW	17	71101029	missense	probably damaging	1.00
R2158:Myom1	UTSW	17	71064597	missense	possibly damaging	0.83
R2336:Myom1	UTSW	17	71023194	missense	possibly damaging	0.53
R2351:Myom1	UTSW	17	71034579	missense	probably damaging	0.98
R2442:Myom1	UTSW	17	71110735	missense	probably damaging	1.00
R2483:Myom1	UTSW	17	71077812	missense	probably damaging	1.00
R2892:Myom1	UTSW	17	71034653	missense	probably damaging	1.00
R2897:Myom1	UTSW	17	71101220	splice site	probably benign
R3440:Myom1	UTSW	17	71045663	splice site	probably null
R3842:Myom1	UTSW	17	71045624	missense	probably damaging	1.00
R4249:Myom1	UTSW	17	71092140	missense	probably damaging	1.00
R4329:Myom1	UTSW	17	71036353	missense	probably damaging	1.00
R4594:Myom1	UTSW	17	71100074	missense	possibly damaging	0.73
R4873:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4875:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4876:Myom1	UTSW	17	71077410	missense	probably damaging	1.00
R5171:Myom1	UTSW	17	71099972	missense	possibly damaging	0.94
R5540:Myom1	UTSW	17	71109787	missense	probably damaging	1.00
R5882:Myom1	UTSW	17	71110722	missense	probably damaging	1.00
R5978:Myom1	UTSW	17	71117443	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6155:Myom1	UTSW	17	71108695	critical splice donor site	probably null
R6261:Myom1	UTSW	17	71126137	missense	probably damaging	1.00
R6313:Myom1	UTSW	17	71082488	missense	probably benign
R6369:Myom1	UTSW	17	71101076	missense	probably damaging	1.00
R6545:Myom1	UTSW	17	71082305	missense	probably benign	0.00
R6738:Myom1	UTSW	17	71100398	splice site	probably null
R6933:Myom1	UTSW	17	71052671	missense	probably damaging	1.00
R7168:Myom1	UTSW	17	71089947	missense	probably benign	0.00
R7286:Myom1	UTSW	17	71045549	missense	possibly damaging	0.90
R7315:Myom1	UTSW	17	71080897	critical splice donor site	probably null
R7672:Myom1	UTSW	17	71084240	missense	possibly damaging	0.92
R7789:Myom1	UTSW	17	71117436	missense	probably benign	0.03
R7898:Myom1	UTSW	17	71045752	missense	probably benign	0.25
R8008:Myom1	UTSW	17	71100062	missense	probably benign	0.30
R8152:Myom1	UTSW	17	71084295	missense	probably damaging	0.96
R8554:Myom1	UTSW	17	71036453	missense	possibly damaging	0.94
R8874:Myom1	UTSW	17	71106204	missense	probably damaging	1.00
R8981:Myom1	UTSW	17	71084321	missense	probably benign	0.09
R9012:Myom1	UTSW	17	71100108	missense	probably benign	0.06
R9090:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9193:Myom1	UTSW	17	71036300	missense	probably damaging	1.00
R9237:Myom1	UTSW	17	71101056	missense	probably damaging	1.00
R9271:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9355:Myom1	UTSW	17	71077893	missense	probably damaging	1.00
R9362:Myom1	UTSW	17	71036293	missense	probably benign	0.00
R9440:Myom1	UTSW	17	71126334	missense	probably benign	0.00
R9469:Myom1	UTSW	17	71061127	missense	possibly damaging	0.79
R9568:Myom1	UTSW	17	71087481	missense	probably damaging	1.00
R9612:Myom1	UTSW	17	71105480	nonsense	probably null
R9645:Myom1	UTSW	17	71092209	missense	probably benign	0.01
X0019:Myom1	UTSW	17	71100071	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- GTTAAGCAGAGCCTACACCC -3'
(R):5'- TTGAGAATGCCGGGATGATG -3'

Sequencing Primer
(F):5'- TTAAGCAGAGCCTACACCCTTTCC -3'
(R):5'- ATGATGCTCCAAGACTGTAGGTC -3'

Posted On

2018-03-15