Mutagenetix > Incidental Mutation

Incidental Mutation 'R6284:Atp5a1'

508140

Institutional Source

Beutler Lab

Gene Symbol

Atp5a1

Ensembl Gene

ENSMUSG00000025428

Gene Name

ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1

Synonyms

Atpm, Mom2, D18Ertd206e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77773729-77782869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 77778468 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 106 (S106T)

Ref Sequence

ENSEMBL: ENSMUSP00000026495 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026495] [ENSMUST00000114748] [ENSMUST00000135678]

AlphaFold

Q03265

Predicted Effect

probably benign
Transcript: ENSMUST00000026495
AA Change: S106T

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000026495
Gene: ENSMUSG00000025428
AA Change: S106T

Domain	Start	End	E-Value	Type
low complexity region	4	21	N/A	INTRINSIC
Pfam:ATP-synt_ab_N	67	135	3.4e-17	PFAM
Pfam:ATP-synt_ab	192	415	5.7e-76	PFAM
Pfam:ATP-synt_ab_C	427	528	1.3e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114748
AA Change: S56T

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000110396
Gene: ENSMUSG00000025428
AA Change: S56T

Domain	Start	End	E-Value	Type
Pfam:ATP-synt_ab_N	17	85	1.1e-19	PFAM
Pfam:ATP-synt_ab	141	365	4.8e-75	PFAM
Pfam:ATP-synt_ab_C	377	479	2e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128073

Predicted Effect

probably benign
Transcript: ENSMUST00000135678

SMART Domains

Protein: ENSMUSP00000120436
Gene: ENSMUSG00000025428

Domain	Start	End	E-Value	Type
low complexity region	4	21	N/A	INTRINSIC
PDB:2W6J\|C	22	78	5e-27	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146869

Meta Mutation Damage Score

0.1413

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, using an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the alpha subunit of the catalytic core. Alternatively spliced transcript variants encoding the different isoforms have been identified. Pseudogenes of this gene are located on chromosomes 9, 2, and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a targeted mutation of this gene display preweaning and embryonic lethality. Heterozygous mutants exhibit decreased body weight and lean body mass and reduced circulating insulin, serum albumin, and total protein levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	G	T	6: 72,347,454	G16C	probably damaging	Het
Abca7	G	A	10: 80,004,410	V801I	probably benign	Het
Adgrl2	A	T	3: 148,826,507	L1030Q	probably damaging	Het
Akap1	T	C	11: 88,844,568	T423A	possibly damaging	Het
Anpep	T	A	7: 79,825,802	D111V	probably damaging	Het
Atm	T	A	9: 53,445,376		probably null	Het
Atp5k	T	C	5: 108,434,059	I20V	probably benign	Het
Atp6v0d2	T	A	4: 19,922,605		probably null	Het
Bclaf1	T	G	10: 20,322,160		probably null	Het
Bod1l	A	G	5: 41,818,787	V1728A	probably benign	Het
Braf	A	G	6: 39,688,282	F51L	possibly damaging	Het
Camsap2	A	G	1: 136,304,437	I140T	possibly damaging	Het
Ccdc24	A	T	4: 117,869,653		probably null	Het
Cdh26	G	C	2: 178,449,884	G79R	probably damaging	Het
Cenpf	A	G	1: 189,652,742	L2447P	probably damaging	Het
Cfap74	T	C	4: 155,451,796	F863L	probably damaging	Het
Clstn2	C	T	9: 97,454,674	G917S	probably benign	Het
Col6a6	A	T	9: 105,727,227		probably null	Het
Cul5	G	A	9: 53,623,735	P596L	probably damaging	Het
Dst	A	T	1: 34,229,085	R2863W	probably damaging	Het
Dthd1	A	G	5: 62,814,041	E69G	possibly damaging	Het
Erich2	T	A	2: 70,539,684	I402N	probably damaging	Het
Fam160a1	G	A	3: 85,672,688	P737S	probably benign	Het
Fam162b	T	C	10: 51,585,502	K155R	probably damaging	Het
Glb1l2	A	T	9: 26,767,448	S466T	probably benign	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gm5724	T	C	6: 141,725,393	D451G	probably damaging	Het
Ikbkap	A	T	4: 56,762,281	I1106K	probably damaging	Het
Kazn	G	A	4: 142,117,197	L402F	probably benign	Het
Kcnj13	A	T	1: 87,386,886	S205T	probably damaging	Het
Lama1	T	A	17: 67,810,096	V2462E	probably damaging	Het
Lce1b	A	C	3: 92,656,104	C41G	unknown	Het
Lyar	T	A	5: 38,225,995	W77R	probably damaging	Het
March11	G	A	15: 26,409,346	R377Q	probably benign	Het
Mis18bp1	A	G	12: 65,138,787	F869L	probably benign	Het
Myom1	T	A	17: 71,022,892	Y6*	probably null	Het
Myzap	T	C	9: 71,558,925	I150V	probably benign	Het
Nop14	C	T	5: 34,641,491		probably null	Het
Oprl1	T	A	2: 181,717,991		probably benign	Het
Pacsin1	T	C	17: 27,708,504	L432P	probably damaging	Het
Peak1	A	G	9: 56,260,296	L116P	probably benign	Het
Plcb2	C	T	2: 118,717,301	V482M	probably benign	Het
Pnliprp1	T	A	19: 58,734,984	I269N	probably damaging	Het
Pnpla7	C	A	2: 25,016,618	D664E	possibly damaging	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Rps6kb2	G	T	19: 4,161,187	T113K	probably benign	Het
Rrp7a	A	T	15: 83,121,860	I63N	probably damaging	Het
Slc29a1	A	G	17: 45,589,921		probably null	Het
Stxbp5	A	C	10: 9,767,179	S1059A	probably benign	Het
Stxbp5	C	A	10: 9,767,187	G1056V	probably damaging	Het
Taldo1	T	A	7: 141,398,583	S149T	possibly damaging	Het
Tlr1	T	C	5: 64,927,099	D45G	possibly damaging	Het
Tnrc6a	T	C	7: 123,171,335	S783P	probably damaging	Het
Trap1	A	G	16: 4,060,809	Y220H	probably benign	Het
Trpc6	A	G	9: 8,643,600	D462G	possibly damaging	Het
Ttc21a	A	G	9: 119,943,962	E235G	probably damaging	Het
Tubb4a	A	G	17: 57,080,833	Y398H	probably damaging	Het
Ube2z	A	G	11: 96,050,407	F303S	probably damaging	Het
Vmn1r211	A	G	13: 22,852,084	S138P	probably damaging	Het
Zfp93	T	A	7: 24,275,629	C346*	probably null	Het
Zfp938	A	T	10: 82,227,566	S52R	possibly damaging	Het
Zp1	A	T	19: 10,916,503	L446Q	probably damaging	Het

Other mutations in Atp5a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01419:Atp5a1	APN	18	77777533	missense	probably damaging	1.00
IGL01536:Atp5a1	APN	18	77780312	intron	probably benign
IGL01585:Atp5a1	APN	18	77781058	missense	possibly damaging	0.95
IGL02973:Atp5a1	APN	18	77780149	missense	probably damaging	1.00
R0268:Atp5a1	UTSW	18	77780195	missense	probably damaging	0.96
R0344:Atp5a1	UTSW	18	77780195	missense	probably damaging	0.96
R0399:Atp5a1	UTSW	18	77781836	nonsense	probably null
R0464:Atp5a1	UTSW	18	77779922	missense	probably benign	0.04
R1471:Atp5a1	UTSW	18	77781269	missense	probably damaging	1.00
R1476:Atp5a1	UTSW	18	77781925	missense	probably benign	0.00
R1630:Atp5a1	UTSW	18	77777567	missense	possibly damaging	0.94
R2102:Atp5a1	UTSW	18	77782317	missense	probably damaging	0.99
R4424:Atp5a1	UTSW	18	77780066	intron	probably benign
R4746:Atp5a1	UTSW	18	77778742	missense	probably benign	0.00
R4864:Atp5a1	UTSW	18	77781315	missense	possibly damaging	0.84
R5191:Atp5a1	UTSW	18	77780229	missense	probably damaging	1.00
R6217:Atp5a1	UTSW	18	77781356	missense	probably benign
R6262:Atp5a1	UTSW	18	77781212	missense	probably damaging	1.00
R6263:Atp5a1	UTSW	18	77779230	splice site	probably null
R6873:Atp5a1	UTSW	18	77775840	nonsense	probably null
R7442:Atp5a1	UTSW	18	77779120	missense	probably benign	0.04
R7661:Atp5a1	UTSW	18	77774102	missense	possibly damaging	0.70
R7696:Atp5a1	UTSW	18	77780986	missense	probably damaging	1.00
R7846:Atp5a1	UTSW	18	77781315	missense	possibly damaging	0.84
R8473:Atp5a1	UTSW	18	77779925	missense	probably damaging	1.00
R8785:Atp5a1	UTSW	18	77779223	missense	probably benign	0.05
R9062:Atp5a1	UTSW	18	77778759	nonsense	probably null
R9275:Atp5a1	UTSW	18	77781297	missense	probably damaging	1.00
R9301:Atp5a1	UTSW	18	77781238	missense	probably damaging	1.00
X0021:Atp5a1	UTSW	18	77781273	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGTTCCGCAGATGCTTG -3'
(R):5'- TTAGCTGTGATGTCGGCCAC -3'

Sequencing Primer
(F):5'- CTCCAGTGTGCAGTGTGGC -3'
(R):5'- TAAGCAGTAACCCACCTTTCC -3'

Posted On

2018-03-15