Incidental Mutation 'R6284:Atp5a1'
List |< first << previous [record 7 of 63] next >> last >|
ID508140
Institutional Source Beutler Lab
Gene Symbol Atp5a1
Ensembl Gene ENSMUSG00000025428
Gene NameATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1
SynonymsAtpm, Mom2, D18Ertd206e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77773729-77782869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77778468 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 106 (S106T)
Ref Sequence ENSEMBL: ENSMUSP00000026495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026495] [ENSMUST00000114748] [ENSMUST00000135678]
Predicted Effect probably benign
Transcript: ENSMUST00000026495
AA Change: S106T

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026495
Gene: ENSMUSG00000025428
AA Change: S106T

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
Pfam:ATP-synt_ab_N 67 135 3.4e-17 PFAM
Pfam:ATP-synt_ab 192 415 5.7e-76 PFAM
Pfam:ATP-synt_ab_C 427 528 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114748
AA Change: S56T

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110396
Gene: ENSMUSG00000025428
AA Change: S56T

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 17 85 1.1e-19 PFAM
Pfam:ATP-synt_ab 141 365 4.8e-75 PFAM
Pfam:ATP-synt_ab_C 377 479 2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128073
Predicted Effect probably benign
Transcript: ENSMUST00000135678
SMART Domains Protein: ENSMUSP00000120436
Gene: ENSMUSG00000025428

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
PDB:2W6J|C 22 78 5e-27 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146869
Meta Mutation Damage Score 0.1413 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, using an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the alpha subunit of the catalytic core. Alternatively spliced transcript variants encoding the different isoforms have been identified. Pseudogenes of this gene are located on chromosomes 9, 2, and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a targeted mutation of this gene display preweaning and embryonic lethality. Heterozygous mutants exhibit decreased body weight and lean body mass and reduced circulating insulin, serum albumin, and total protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Atp5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Atp5a1 APN 18 77777533 missense probably damaging 1.00
IGL01536:Atp5a1 APN 18 77780312 intron probably benign
IGL01585:Atp5a1 APN 18 77781058 missense possibly damaging 0.95
IGL02973:Atp5a1 APN 18 77780149 missense probably damaging 1.00
R0268:Atp5a1 UTSW 18 77780195 missense probably damaging 0.96
R0344:Atp5a1 UTSW 18 77780195 missense probably damaging 0.96
R0399:Atp5a1 UTSW 18 77781836 nonsense probably null
R0464:Atp5a1 UTSW 18 77779922 missense probably benign 0.04
R1471:Atp5a1 UTSW 18 77781269 missense probably damaging 1.00
R1476:Atp5a1 UTSW 18 77781925 missense probably benign 0.00
R1630:Atp5a1 UTSW 18 77777567 missense possibly damaging 0.94
R2102:Atp5a1 UTSW 18 77782317 missense probably damaging 0.99
R4424:Atp5a1 UTSW 18 77780066 intron probably benign
R4746:Atp5a1 UTSW 18 77778742 missense probably benign 0.00
R4864:Atp5a1 UTSW 18 77781315 missense possibly damaging 0.84
R5191:Atp5a1 UTSW 18 77780229 missense probably damaging 1.00
R6217:Atp5a1 UTSW 18 77781356 missense probably benign
R6262:Atp5a1 UTSW 18 77781212 missense probably damaging 1.00
R6263:Atp5a1 UTSW 18 77779230 splice site probably null
R6873:Atp5a1 UTSW 18 77775840 nonsense probably null
R7442:Atp5a1 UTSW 18 77779120 missense probably benign 0.04
R7661:Atp5a1 UTSW 18 77774102 missense possibly damaging 0.70
R7696:Atp5a1 UTSW 18 77780986 missense probably damaging 1.00
R7846:Atp5a1 UTSW 18 77781315 missense possibly damaging 0.84
X0021:Atp5a1 UTSW 18 77781273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTTCCGCAGATGCTTG -3'
(R):5'- TTAGCTGTGATGTCGGCCAC -3'

Sequencing Primer
(F):5'- CTCCAGTGTGCAGTGTGGC -3'
(R):5'- TAAGCAGTAACCCACCTTTCC -3'
Posted On2018-03-15