Incidental Mutation 'R6284:Zp1'
List |< first << previous [record 63 of 63]
ID508142
Institutional Source Beutler Lab
Gene Symbol Zp1
Ensembl Gene ENSMUSG00000024734
Gene Namezona pellucida glycoprotein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10914287-10920632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10916503 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 446 (L446Q)
Ref Sequence ENSEMBL: ENSMUSP00000025641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025641] [ENSMUST00000168708]
Predicted Effect probably damaging
Transcript: ENSMUST00000025641
AA Change: L446Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025641
Gene: ENSMUSG00000024734
AA Change: L446Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
PD 226 269 2.33e-11 SMART
ZP 271 542 1.55e-102 SMART
low complexity region 580 589 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168708
SMART Domains Protein: ENSMUSP00000128543
Gene: ENSMUSG00000024734

DomainStartEndE-ValueType
Pfam:Zona_pellucida 3 61 5.6e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene ensures the structural integrity of the zona pellucida. Mutations in this gene are a cause of oocyte maturation defect and infertility. [provided by RefSeq, May 2014]
PHENOTYPE: Female homozygous mutants produce oocytes with abnormal zona pellucida. Fecunditiy is significantly reduced, probably due to precocious hatching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Other mutations in Zp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zp1 APN 19 10918777 missense probably damaging 1.00
IGL01504:Zp1 APN 19 10919011 missense probably damaging 0.99
IGL02260:Zp1 APN 19 10916714 unclassified probably benign
IGL02465:Zp1 APN 19 10920487 missense probably benign 0.09
IGL02634:Zp1 APN 19 10919507 unclassified probably benign
IGL02714:Zp1 APN 19 10918612 missense probably damaging 1.00
IGL03234:Zp1 APN 19 10914823 splice site probably benign
IGL03404:Zp1 APN 19 10914461 unclassified probably benign
R0504:Zp1 UTSW 19 10916207 missense probably damaging 0.98
R0554:Zp1 UTSW 19 10920562 missense probably benign 0.29
R1028:Zp1 UTSW 19 10918911 missense probably benign 0.01
R1279:Zp1 UTSW 19 10918577 missense probably damaging 1.00
R1460:Zp1 UTSW 19 10918878 missense probably benign
R3425:Zp1 UTSW 19 10918592 missense probably benign 0.00
R3832:Zp1 UTSW 19 10916524 missense probably damaging 1.00
R4420:Zp1 UTSW 19 10914760 splice site probably null
R4669:Zp1 UTSW 19 10918905 missense probably benign 0.31
R4849:Zp1 UTSW 19 10918834 missense possibly damaging 0.90
R5134:Zp1 UTSW 19 10920562 missense probably benign 0.29
R5170:Zp1 UTSW 19 10920554 missense possibly damaging 0.56
R5510:Zp1 UTSW 19 10919405 missense probably damaging 1.00
R6307:Zp1 UTSW 19 10916720 missense probably null 0.45
R6378:Zp1 UTSW 19 10914853 missense probably benign 0.15
R6608:Zp1 UTSW 19 10918980 missense possibly damaging 0.93
R6697:Zp1 UTSW 19 10914835 missense probably benign 0.05
R6862:Zp1 UTSW 19 10916513 missense possibly damaging 0.84
R7054:Zp1 UTSW 19 10918740 missense probably damaging 0.98
R7253:Zp1 UTSW 19 10916569 missense probably damaging 0.99
R7483:Zp1 UTSW 19 10917916 missense possibly damaging 0.72
R7591:Zp1 UTSW 19 10919471 missense probably damaging 1.00
Z1176:Zp1 UTSW 19 10917914 missense probably damaging 1.00
Z1177:Zp1 UTSW 19 10918604 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCGCTGATAGTGGGAC -3'
(R):5'- CTAAAGCCTTACAGCCTGTCC -3'

Sequencing Primer
(F):5'- TCTGTAGTTGTCACCCTTGAAAG -3'
(R):5'- CTGTCCCAGGCTCACAAG -3'
Posted On2018-03-15