Incidental Mutation 'R6285:Dennd1a'
ID508148
Institutional Source Beutler Lab
Gene Symbol Dennd1a
Ensembl Gene ENSMUSG00000035392
Gene NameDENN/MADD domain containing 1A
Synonyms6030446I19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R6285 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37798991-38287390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37852441 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 437 (H437Q)
Ref Sequence ENSEMBL: ENSMUSP00000099848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102787] [ENSMUST00000136460] [ENSMUST00000140552]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102787
AA Change: H437Q

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099848
Gene: ENSMUSG00000035392
AA Change: H437Q

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
DENN 92 273 2.09e-73 SMART
dDENN 304 371 1.37e-18 SMART
low complexity region 497 508 N/A INTRINSIC
low complexity region 689 702 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 801 815 N/A INTRINSIC
low complexity region 822 856 N/A INTRINSIC
low complexity region 952 972 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136460
SMART Domains Protein: ENSMUSP00000115527
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
low complexity region 102 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140552
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1A, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,072,224 K28R probably benign Het
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cd79a A G 7: 24,899,347 N107S possibly damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Golga4 C T 9: 118,558,627 R616* probably null Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hipk3 T C 2: 104,471,425 M141V probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Kcp C A 6: 29,502,365 V227L probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Nrd1 G T 4: 109,038,006 V476F probably damaging Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pcdhgc5 A T 18: 37,820,621 Y316F probably benign Het
Pecam1 T C 11: 106,685,239 D490G probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Ppp2r5b T A 19: 6,230,536 Q304L probably benign Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptk6 A T 2: 181,197,093 L289Q probably null Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sept8 G T 11: 53,534,767 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Tbx6 A G 7: 126,781,568 Q21R possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in Dennd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd1a APN 2 38243442 nonsense probably null
IGL00490:Dennd1a APN 2 37801152 missense probably damaging 1.00
IGL00839:Dennd1a APN 2 37816982 missense probably benign 0.30
IGL01065:Dennd1a APN 2 37844905 missense probably benign 0.02
IGL01621:Dennd1a APN 2 37844809 missense probably damaging 1.00
IGL01792:Dennd1a APN 2 38126580 missense probably damaging 1.00
IGL01799:Dennd1a APN 2 38048742 missense probably damaging 1.00
IGL02516:Dennd1a APN 2 37852394 critical splice donor site probably null
contract UTSW 2 37852441 missense possibly damaging 0.89
R0018:Dennd1a UTSW 2 37858460 missense possibly damaging 0.72
R0018:Dennd1a UTSW 2 37858460 missense possibly damaging 0.72
R0144:Dennd1a UTSW 2 38126640 missense probably damaging 0.96
R0784:Dennd1a UTSW 2 38021414 missense probably damaging 1.00
R1199:Dennd1a UTSW 2 37961716 missense probably damaging 0.99
R1439:Dennd1a UTSW 2 38043400 missense probably damaging 1.00
R1563:Dennd1a UTSW 2 37858429 missense probably damaging 1.00
R1608:Dennd1a UTSW 2 37852434 missense probably benign 0.18
R1720:Dennd1a UTSW 2 37800197 nonsense probably null
R1967:Dennd1a UTSW 2 37844833 missense probably benign
R2570:Dennd1a UTSW 2 37844783 missense probably damaging 1.00
R3886:Dennd1a UTSW 2 37858077 missense possibly damaging 0.89
R4464:Dennd1a UTSW 2 38243390 splice site probably benign
R4890:Dennd1a UTSW 2 38176226 intron probably benign
R5395:Dennd1a UTSW 2 37802128 missense probably damaging 1.00
R5652:Dennd1a UTSW 2 37801126 missense probably benign 0.00
R5882:Dennd1a UTSW 2 37961663 missense probably damaging 1.00
R6520:Dennd1a UTSW 2 37961747 splice site probably null
R6934:Dennd1a UTSW 2 37801213 missense possibly damaging 0.62
R7053:Dennd1a UTSW 2 37961654 missense probably damaging 1.00
R7109:Dennd1a UTSW 2 38048792 missense probably damaging 1.00
R7204:Dennd1a UTSW 2 38039203 missense probably damaging 1.00
R7235:Dennd1a UTSW 2 37801061 missense probably benign
R7408:Dennd1a UTSW 2 37852172 intron probably null
R7446:Dennd1a UTSW 2 37816979 missense possibly damaging 0.89
R7579:Dennd1a UTSW 2 37858432 missense probably damaging 0.99
R7645:Dennd1a UTSW 2 38021363 missense probably damaging 1.00
R7661:Dennd1a UTSW 2 37844829 missense probably benign
R8132:Dennd1a UTSW 2 37858060 missense probably damaging 1.00
R8305:Dennd1a UTSW 2 37858081 missense probably damaging 1.00
R8369:Dennd1a UTSW 2 38048754 missense probably damaging 1.00
Z1088:Dennd1a UTSW 2 37800692 missense probably benign
Z1177:Dennd1a UTSW 2 37800257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAGCTGGTAATGCATTTTGAAG -3'
(R):5'- AATCTCTGCCGCTCCTTTAAGG -3'

Sequencing Primer
(F):5'- GAAGTGTGCTAACAACACTGTATC -3'
(R):5'- GAGAAGGTGATTCATGGTG -3'
Posted On2018-03-15