Mutagenetix > Incidental Mutation

Incidental Mutation 'R6285:Ptprt'

508152

Institutional Source

Beutler Lab

Gene Symbol

Ptprt

Ensembl Gene

ENSMUSG00000053141

Gene Name

protein tyrosine phosphatase, receptor type, T

Synonyms

RPTPrho

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R6285 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

161521990-162661147 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 161901497 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 508 (I508N)

Ref Sequence

ENSEMBL: ENSMUSP00000105068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109441
AA Change: I508N

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: I508N

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
transmembrane domain	753	772	N/A	INTRINSIC
PTPc	882	1159	3.64e-129	SMART
PTPc	1188	1453	4.24e-98	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109442
AA Change: I508N

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: I508N

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
low complexity region	738	749	N/A	INTRINSIC
transmembrane domain	772	791	N/A	INTRINSIC
PTPc	901	1158	5.56e-134	SMART
PTPc	1187	1452	4.24e-98	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109443
AA Change: I508N

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: I508N

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
low complexity region	778	792	N/A	INTRINSIC
PTPc	892	1149	5.56e-134	SMART
PTPc	1178	1443	4.24e-98	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109445
AA Change: I508N

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: I508N

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
transmembrane domain	753	772	N/A	INTRINSIC
PTPc	882	1139	5.56e-134	SMART
PTPc	1168	1433	4.24e-98	SMART

Meta Mutation Damage Score

0.6726

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.8%
20x: 96.9%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	A	G	18: 59,072,224	K28R	probably benign	Het
Acad9	A	T	3: 36,082,175	M370L	probably benign	Het
Aimp1	A	G	3: 132,667,504	M225T	possibly damaging	Het
Atp8a1	T	C	5: 67,667,607	I809V	possibly damaging	Het
Bbs10	A	G	10: 111,299,761	Y245C	probably damaging	Het
Cabin1	A	T	10: 75,684,323	F1572Y	probably damaging	Het
Cd79a	A	G	7: 24,899,347	N107S	possibly damaging	Het
Cdc7	G	A	5: 106,983,059	A428T	probably benign	Het
Cep290	A	G	10: 100,523,329	T974A	probably benign	Het
Cep350	A	T	1: 155,953,374	N261K	possibly damaging	Het
Cfap46	T	A	7: 139,661,085	D8V	probably damaging	Het
Col6a4	T	C	9: 106,074,986	D571G	probably damaging	Het
Cpe	A	C	8: 64,617,611	V200G	probably benign	Het
Ctnnd1	C	T	2: 84,613,887		probably null	Het
D5Ertd579e	A	C	5: 36,615,577	C491W	probably damaging	Het
Dek	A	G	13: 47,099,380	I183T	probably damaging	Het
Dennd1a	A	T	2: 37,852,441	H437Q	possibly damaging	Het
Dido1	C	T	2: 180,661,147	A1655T	probably benign	Het
Eva1b	A	G	4: 126,149,485	D106G	probably damaging	Het
Evc2	G	T	5: 37,424,579	S1189I	possibly damaging	Het
Faap100	A	T	11: 120,376,732	L405Q	probably damaging	Het
Fbxw15	T	A	9: 109,557,166	M249L	probably benign	Het
Gbp10	A	T	5: 105,218,460	L526Q	probably damaging	Het
Gm13084	A	G	4: 143,816,039	C4R	probably damaging	Het
Gm14025	T	G	2: 129,037,799	T736P	possibly damaging	Het
Gm19402	A	C	10: 77,690,520		probably benign	Het
Gm2244	A	G	14: 19,540,797	Y141H	probably damaging	Het
Gm4181	A	T	14: 51,633,209	N98K	probably damaging	Het
Gm765	T	C	6: 98,238,173	D163G	probably damaging	Het
Golga4	C	T	9: 118,558,627	R616*	probably null	Het
Gpank1	T	A	17: 35,124,290	S226T	probably damaging	Het
Hipk3	T	C	2: 104,471,425	M141V	probably damaging	Het
Hoxc11	T	C	15: 102,954,743	V73A	probably benign	Het
Igf1r	T	G	7: 68,004,137	I141S	possibly damaging	Het
Jak2	T	A	19: 29,295,659	F628I	probably benign	Het
Kcp	C	A	6: 29,502,365	V227L	probably benign	Het
Knl1	T	G	2: 119,071,941	C1374W	probably damaging	Het
Larp6	A	T	9: 60,737,760	R394S	probably benign	Het
Lilra5	G	A	7: 4,242,115	G253R	probably damaging	Het
Map3k4	A	G	17: 12,264,058	S591P	probably damaging	Het
Mrpl16	T	A	19: 11,772,968	I72K	probably damaging	Het
Nol11	C	G	11: 107,181,034	R244S	probably benign	Het
Nr2f1	T	C	13: 78,195,663	T161A	probably benign	Het
Nrd1	G	T	4: 109,038,006	V476F	probably damaging	Het
Olfr1406	G	T	1: 173,183,910	H175N	probably damaging	Het
Olfr419	A	T	1: 174,250,829	S33T	possibly damaging	Het
Olfr451-ps1	A	T	6: 42,800,909	H56L	probably benign	Het
Olfr535	T	A	7: 140,492,713	L25Q	possibly damaging	Het
P2rx1	A	G	11: 73,008,148	I62V	probably benign	Het
Pcdhgc5	A	T	18: 37,820,621	Y316F	probably benign	Het
Pecam1	T	C	11: 106,685,239	D490G	probably benign	Het
Pfkfb2	A	T	1: 130,707,562	Y87*	probably null	Het
Poldip2	A	G	11: 78,517,632		probably null	Het
Ppp2r5b	T	A	19: 6,230,536	Q304L	probably benign	Het
Psg26	A	G	7: 18,482,828	F29L	probably benign	Het
Ptk6	A	T	2: 181,197,093	L289Q	probably null	Het
Rasgrp4	T	C	7: 29,148,383	F406S	probably damaging	Het
Rspo3	A	G	10: 29,499,930		probably null	Het
Sept8	G	T	11: 53,534,767		probably null	Het
Sirt2	A	C	7: 28,788,046	T345P	probably benign	Het
Slc6a20b	T	C	9: 123,609,096	E205G	possibly damaging	Het
Sqstm1	G	A	11: 50,202,591	Q327*	probably null	Het
Susd3	T	A	13: 49,237,521	S98C	probably damaging	Het
Tada2b	G	A	5: 36,476,842	R56W	probably damaging	Het
Tbc1d2	A	T	4: 46,615,045	V546E	possibly damaging	Het
Tbx6	A	G	7: 126,781,568	Q21R	possibly damaging	Het
Usp24	T	G	4: 106,374,100		probably null	Het
Vmn2r103	A	G	17: 19,812,144	T727A	probably benign	Het
Wdr48	C	T	9: 119,920,610	T531M	probably damaging	Het

Other mutations in Ptprt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ptprt	APN	2	161810624	missense	probably benign	0.00
IGL00565:Ptprt	APN	2	161560191	missense	probably damaging	1.00
IGL00925:Ptprt	APN	2	161656163	missense	possibly damaging	0.52
IGL01344:Ptprt	APN	2	161551817	missense	probably damaging	1.00
IGL01432:Ptprt	APN	2	162268079	splice site	probably benign
IGL02008:Ptprt	APN	2	161927673	missense	probably benign	0.02
IGL02040:Ptprt	APN	2	162238072	missense	probably damaging	1.00
IGL02172:Ptprt	APN	2	161555502	missense	probably damaging	1.00
IGL02231:Ptprt	APN	2	162238060	missense	probably damaging	1.00
IGL02231:Ptprt	APN	2	162278046	critical splice donor site	probably null
IGL02232:Ptprt	APN	2	161530517	missense	probably damaging	0.96
IGL02277:Ptprt	APN	2	161547381	missense	probably damaging	1.00
IGL02447:Ptprt	APN	2	162278107	missense	probably benign	0.01
IGL02601:Ptprt	APN	2	161766307	missense	probably benign	0.10
IGL02623:Ptprt	APN	2	161607452	splice site	probably benign
IGL03379:Ptprt	APN	2	161555459	nonsense	probably null
Poverina	UTSW	2	161901497	missense	possibly damaging	0.70
IGL03055:Ptprt	UTSW	2	161533613	missense	probably damaging	0.96
R0064:Ptprt	UTSW	2	161927791	splice site	probably benign
R0129:Ptprt	UTSW	2	162278070	missense	probably benign	0.35
R0131:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0131:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0132:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0316:Ptprt	UTSW	2	161607319	missense	probably damaging	1.00
R0454:Ptprt	UTSW	2	161553822	missense	probably damaging	0.96
R0488:Ptprt	UTSW	2	161553825	missense	probably damaging	0.99
R0573:Ptprt	UTSW	2	161551748	missense	probably damaging	1.00
R0614:Ptprt	UTSW	2	161812120	missense	possibly damaging	0.59
R0834:Ptprt	UTSW	2	161812139	splice site	probably null
R1023:Ptprt	UTSW	2	161558943	missense	probably damaging	1.00
R1184:Ptprt	UTSW	2	161927772	missense	possibly damaging	0.82
R1253:Ptprt	UTSW	2	162278226	missense	probably damaging	1.00
R1476:Ptprt	UTSW	2	161927484	missense	probably damaging	1.00
R1515:Ptprt	UTSW	2	162238034	missense	probably damaging	1.00
R1595:Ptprt	UTSW	2	161810549	critical splice donor site	probably null
R1939:Ptprt	UTSW	2	161927640	missense	probably benign	0.45
R1987:Ptprt	UTSW	2	161558898	missense	probably damaging	1.00
R1987:Ptprt	UTSW	2	161766321	missense	possibly damaging	0.48
R2049:Ptprt	UTSW	2	161534545	missense	probably damaging	1.00
R2140:Ptprt	UTSW	2	161811988	missense	probably damaging	1.00
R2421:Ptprt	UTSW	2	162278040	splice site	probably benign
R3432:Ptprt	UTSW	2	161927529	missense	probably damaging	1.00
R3619:Ptprt	UTSW	2	161566157	missense	probably damaging	1.00
R3757:Ptprt	UTSW	2	161812030	missense	probably damaging	1.00
R3758:Ptprt	UTSW	2	161812030	missense	probably damaging	1.00
R3834:Ptprt	UTSW	2	161547387	missense	probably damaging	1.00
R3835:Ptprt	UTSW	2	161547387	missense	probably damaging	1.00
R3915:Ptprt	UTSW	2	161555555	splice site	probably benign
R4003:Ptprt	UTSW	2	161566117	splice site	probably benign
R4387:Ptprt	UTSW	2	161927650	missense	probably damaging	1.00
R4519:Ptprt	UTSW	2	161564689	missense	probably damaging	1.00
R4618:Ptprt	UTSW	2	161553845	missense	probably damaging	1.00
R4677:Ptprt	UTSW	2	161901446	critical splice donor site	probably null
R4866:Ptprt	UTSW	2	161560239	missense	probably damaging	1.00
R5088:Ptprt	UTSW	2	162238175	missense	probably benign	0.01
R5173:Ptprt	UTSW	2	161927756	missense	probably benign	0.01
R5215:Ptprt	UTSW	2	162278164	missense	probably damaging	1.00
R5383:Ptprt	UTSW	2	161698049	missense	probably damaging	1.00
R5398:Ptprt	UTSW	2	161927592	missense	probably damaging	1.00
R5518:Ptprt	UTSW	2	162278223	missense	probably damaging	0.99
R5711:Ptprt	UTSW	2	161810604	missense	probably damaging	0.98
R5735:Ptprt	UTSW	2	161534564	missense	probably damaging	0.98
R5834:Ptprt	UTSW	2	161560269	missense	probably damaging	1.00
R5872:Ptprt	UTSW	2	162135218	missense	probably damaging	1.00
R5926:Ptprt	UTSW	2	161564686	missense	probably benign	0.00
R6210:Ptprt	UTSW	2	162268029	missense	probably damaging	1.00
R6298:Ptprt	UTSW	2	161553859	missense	probably damaging	1.00
R6406:Ptprt	UTSW	2	161553783	missense	probably damaging	0.98
R6499:Ptprt	UTSW	2	161534587	missense	probably benign	0.32
R6613:Ptprt	UTSW	2	161530447	missense	probably damaging	1.00
R6622:Ptprt	UTSW	2	161553840	missense	probably damaging	1.00
R7218:Ptprt	UTSW	2	161547364	missense	probably damaging	1.00
R7247:Ptprt	UTSW	2	161533523	missense	probably benign	0.15
R7576:Ptprt	UTSW	2	161607305	missense	possibly damaging	0.88
R7733:Ptprt	UTSW	2	161575787	missense	probably damaging	1.00
R7735:Ptprt	UTSW	2	161575741	missense	probably damaging	1.00
R7813:Ptprt	UTSW	2	161530493	missense	probably damaging	1.00
R8031:Ptprt	UTSW	2	162135457	missense	probably damaging	1.00
R8074:Ptprt	UTSW	2	161927661	missense	possibly damaging	0.77
R8151:Ptprt	UTSW	2	162278085	missense	probably damaging	1.00
R8236:Ptprt	UTSW	2	161687068	critical splice donor site	probably null
R8308:Ptprt	UTSW	2	161927646	missense	probably benign	0.00
R8348:Ptprt	UTSW	2	161558886	missense	probably damaging	1.00
R8362:Ptprt	UTSW	2	161551747	missense	probably damaging	1.00
R8365:Ptprt	UTSW	2	161901531	missense	probably benign	0.05
R8448:Ptprt	UTSW	2	161558886	missense	probably damaging	1.00
R8512:Ptprt	UTSW	2	161558863	missense	probably benign	0.00
R8715:Ptprt	UTSW	2	161530543	missense	probably damaging	1.00
R9004:Ptprt	UTSW	2	161766394	missense	probably benign	0.04
R9046:Ptprt	UTSW	2	161530441	missense	possibly damaging	0.58
R9222:Ptprt	UTSW	2	161560186	missense	probably damaging	1.00
R9297:Ptprt	UTSW	2	161575778	missense	probably benign
R9318:Ptprt	UTSW	2	161575778	missense	probably benign
R9476:Ptprt	UTSW	2	161555461	missense	probably damaging	1.00
R9510:Ptprt	UTSW	2	161555461	missense	probably damaging	1.00
R9571:Ptprt	UTSW	2	161553812	missense	probably benign	0.10
X0064:Ptprt	UTSW	2	161927483	missense	probably damaging	1.00
Z1088:Ptprt	UTSW	2	162238121	missense	possibly damaging	0.86
Z1177:Ptprt	UTSW	2	161732887	missense	probably damaging	1.00
Z1177:Ptprt	UTSW	2	162362948	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- AATGCCTGGTATGTCCACATG -3'
(R):5'- TTCATTTACAGATCCTCAATGGCC -3'

Sequencing Primer
(F):5'- CTCTTTGGCATGATCAAAATGGCC -3'
(R):5'- TAGTATCAGCCACCAGTC -3'

Posted On

2018-03-15