Incidental Mutation 'R6285:Ptk6'
ID508154
Institutional Source Beutler Lab
Gene Symbol Ptk6
Ensembl Gene ENSMUSG00000038751
Gene NamePTK6 protein tyrosine kinase 6
SynonymsSik, Tksk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6285 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181193721-181202789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181197093 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 289 (L289Q)
Ref Sequence ENSEMBL: ENSMUSP00000016511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016511]
Predicted Effect probably null
Transcript: ENSMUST00000016511
AA Change: L289Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016511
Gene: ENSMUSG00000038751
AA Change: L289Q

DomainStartEndE-ValueType
SH3 11 71 2e-16 SMART
SH2 76 161 1.01e-28 SMART
TyrKc 191 441 1.12e-131 SMART
Meta Mutation Damage Score 0.9304 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic nonreceptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Overexpression of this gene in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Expression of this gene has been detected at low levels in some breast tumors but not in normal breast tissue. The encoded protein has been shown to undergo autophosphorylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele display increased villus length in the jejunum and ileum and increased villus epithelial cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,072,224 K28R probably benign Het
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cd79a A G 7: 24,899,347 N107S possibly damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dennd1a A T 2: 37,852,441 H437Q possibly damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Golga4 C T 9: 118,558,627 R616* probably null Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hipk3 T C 2: 104,471,425 M141V probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Kcp C A 6: 29,502,365 V227L probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Nrd1 G T 4: 109,038,006 V476F probably damaging Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pcdhgc5 A T 18: 37,820,621 Y316F probably benign Het
Pecam1 T C 11: 106,685,239 D490G probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Ppp2r5b T A 19: 6,230,536 Q304L probably benign Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sept8 G T 11: 53,534,767 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Tbx6 A G 7: 126,781,568 Q21R possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in Ptk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Ptk6 APN 2 181195818 missense probably benign 0.00
IGL01630:Ptk6 APN 2 181197066 missense probably damaging 0.99
IGL01862:Ptk6 APN 2 181199640 missense probably benign 0.00
IGL02231:Ptk6 APN 2 181197001 missense probably damaging 1.00
IGL02965:Ptk6 APN 2 181199068 splice site probably benign
R0115:Ptk6 UTSW 2 181202527 start gained probably benign
R0139:Ptk6 UTSW 2 181196931 splice site probably benign
R0245:Ptk6 UTSW 2 181202491 missense probably benign
R0358:Ptk6 UTSW 2 181198522 missense probably benign 0.01
R0416:Ptk6 UTSW 2 181202308 missense possibly damaging 0.94
R0454:Ptk6 UTSW 2 181202282 missense possibly damaging 0.86
R0470:Ptk6 UTSW 2 181195939 missense probably benign
R0481:Ptk6 UTSW 2 181202527 start gained probably benign
R1147:Ptk6 UTSW 2 181195797 missense probably benign 0.23
R1147:Ptk6 UTSW 2 181195797 missense probably benign 0.23
R1234:Ptk6 UTSW 2 181202440 missense possibly damaging 0.94
R2249:Ptk6 UTSW 2 181196380 missense probably benign 0.03
R4842:Ptk6 UTSW 2 181196991 missense possibly damaging 0.89
R5568:Ptk6 UTSW 2 181199695 missense possibly damaging 0.47
R5806:Ptk6 UTSW 2 181199730 missense possibly damaging 0.95
R6017:Ptk6 UTSW 2 181195812 missense probably benign 0.32
R6293:Ptk6 UTSW 2 181198460 missense probably damaging 1.00
R6468:Ptk6 UTSW 2 181199102 missense probably benign
R7369:Ptk6 UTSW 2 181198461 missense possibly damaging 0.86
R8256:Ptk6 UTSW 2 181195840 nonsense probably null
X0062:Ptk6 UTSW 2 181202323 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTAGGTTCAGCTCAAGG -3'
(R):5'- TCTAGGTACATAGCTGCAGAAGG -3'

Sequencing Primer
(F):5'- GCTTGGGAGATAAAGCCCCAC -3'
(R):5'- CATAGCTGCAGAAGGTCTAGGCC -3'
Posted On2018-03-15