Mutagenetix > Incidental Mutation

Incidental Mutation 'R6285:Usp24'

508158

Institutional Source

Beutler Lab

Gene Symbol

Usp24

Ensembl Gene

ENSMUSG00000028514

Gene Name

ubiquitin specific peptidase 24

Synonyms

2810030C21Rik, 2700066K03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6285 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106316213-106441322 bp(+) (GRCm38)

Type of Mutation

splice site (56 bp from exon)

DNA Base Change (assembly)

T to G at 106374100 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133095 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]

AlphaFold

B1AY13

Predicted Effect

probably null
Transcript: ENSMUST00000094933

SMART Domains

Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	882	6e-7	SMART
low complexity region	1031	1059	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1365	1378	N/A	INTRINSIC
Pfam:UCH	1685	2036	3.7e-54	PFAM
Pfam:UCH_1	1686	1993	1.8e-27	PFAM
low complexity region	2066	2081	N/A	INTRINSIC
low complexity region	2256	2267	N/A	INTRINSIC
low complexity region	2576	2592	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000165709

SMART Domains

Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	883	8e-7	SMART
low complexity region	1032	1060	N/A	INTRINSIC
low complexity region	1125	1151	N/A	INTRINSIC
low complexity region	1366	1379	N/A	INTRINSIC
Pfam:UCH	1686	2037	2e-49	PFAM
Pfam:UCH_1	1687	1994	4e-24	PFAM
low complexity region	2067	2082	N/A	INTRINSIC
low complexity region	2257	2268	N/A	INTRINSIC
low complexity region	2577	2593	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.8%
20x: 96.9%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	A	G	18: 59,072,224	K28R	probably benign	Het
Acad9	A	T	3: 36,082,175	M370L	probably benign	Het
Aimp1	A	G	3: 132,667,504	M225T	possibly damaging	Het
Atp8a1	T	C	5: 67,667,607	I809V	possibly damaging	Het
Bbs10	A	G	10: 111,299,761	Y245C	probably damaging	Het
Cabin1	A	T	10: 75,684,323	F1572Y	probably damaging	Het
Cd79a	A	G	7: 24,899,347	N107S	possibly damaging	Het
Cdc7	G	A	5: 106,983,059	A428T	probably benign	Het
Cep290	A	G	10: 100,523,329	T974A	probably benign	Het
Cep350	A	T	1: 155,953,374	N261K	possibly damaging	Het
Cfap46	T	A	7: 139,661,085	D8V	probably damaging	Het
Col6a4	T	C	9: 106,074,986	D571G	probably damaging	Het
Cpe	A	C	8: 64,617,611	V200G	probably benign	Het
Ctnnd1	C	T	2: 84,613,887		probably null	Het
D5Ertd579e	A	C	5: 36,615,577	C491W	probably damaging	Het
Dek	A	G	13: 47,099,380	I183T	probably damaging	Het
Dennd1a	A	T	2: 37,852,441	H437Q	possibly damaging	Het
Dido1	C	T	2: 180,661,147	A1655T	probably benign	Het
Eva1b	A	G	4: 126,149,485	D106G	probably damaging	Het
Evc2	G	T	5: 37,424,579	S1189I	possibly damaging	Het
Faap100	A	T	11: 120,376,732	L405Q	probably damaging	Het
Fbxw15	T	A	9: 109,557,166	M249L	probably benign	Het
Gbp10	A	T	5: 105,218,460	L526Q	probably damaging	Het
Gm13084	A	G	4: 143,816,039	C4R	probably damaging	Het
Gm14025	T	G	2: 129,037,799	T736P	possibly damaging	Het
Gm19402	A	C	10: 77,690,520		probably benign	Het
Gm2244	A	G	14: 19,540,797	Y141H	probably damaging	Het
Gm4181	A	T	14: 51,633,209	N98K	probably damaging	Het
Gm765	T	C	6: 98,238,173	D163G	probably damaging	Het
Golga4	C	T	9: 118,558,627	R616*	probably null	Het
Gpank1	T	A	17: 35,124,290	S226T	probably damaging	Het
Hipk3	T	C	2: 104,471,425	M141V	probably damaging	Het
Hoxc11	T	C	15: 102,954,743	V73A	probably benign	Het
Igf1r	T	G	7: 68,004,137	I141S	possibly damaging	Het
Jak2	T	A	19: 29,295,659	F628I	probably benign	Het
Kcp	C	A	6: 29,502,365	V227L	probably benign	Het
Knl1	T	G	2: 119,071,941	C1374W	probably damaging	Het
Larp6	A	T	9: 60,737,760	R394S	probably benign	Het
Lilra5	G	A	7: 4,242,115	G253R	probably damaging	Het
Map3k4	A	G	17: 12,264,058	S591P	probably damaging	Het
Mrpl16	T	A	19: 11,772,968	I72K	probably damaging	Het
Nol11	C	G	11: 107,181,034	R244S	probably benign	Het
Nr2f1	T	C	13: 78,195,663	T161A	probably benign	Het
Nrd1	G	T	4: 109,038,006	V476F	probably damaging	Het
Olfr1406	G	T	1: 173,183,910	H175N	probably damaging	Het
Olfr419	A	T	1: 174,250,829	S33T	possibly damaging	Het
Olfr451-ps1	A	T	6: 42,800,909	H56L	probably benign	Het
Olfr535	T	A	7: 140,492,713	L25Q	possibly damaging	Het
P2rx1	A	G	11: 73,008,148	I62V	probably benign	Het
Pcdhgc5	A	T	18: 37,820,621	Y316F	probably benign	Het
Pecam1	T	C	11: 106,685,239	D490G	probably benign	Het
Pfkfb2	A	T	1: 130,707,562	Y87*	probably null	Het
Poldip2	A	G	11: 78,517,632		probably null	Het
Ppp2r5b	T	A	19: 6,230,536	Q304L	probably benign	Het
Psg26	A	G	7: 18,482,828	F29L	probably benign	Het
Ptk6	A	T	2: 181,197,093	L289Q	probably null	Het
Ptprt	A	T	2: 161,901,497	I508N	possibly damaging	Het
Rasgrp4	T	C	7: 29,148,383	F406S	probably damaging	Het
Rspo3	A	G	10: 29,499,930		probably null	Het
Sept8	G	T	11: 53,534,767		probably null	Het
Sirt2	A	C	7: 28,788,046	T345P	probably benign	Het
Slc6a20b	T	C	9: 123,609,096	E205G	possibly damaging	Het
Sqstm1	G	A	11: 50,202,591	Q327*	probably null	Het
Susd3	T	A	13: 49,237,521	S98C	probably damaging	Het
Tada2b	G	A	5: 36,476,842	R56W	probably damaging	Het
Tbc1d2	A	T	4: 46,615,045	V546E	possibly damaging	Het
Tbx6	A	G	7: 126,781,568	Q21R	possibly damaging	Het
Vmn2r103	A	G	17: 19,812,144	T727A	probably benign	Het
Wdr48	C	T	9: 119,920,610	T531M	probably damaging	Het

Other mutations in Usp24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Usp24	APN	4	106359091	missense	probably benign
IGL00340:Usp24	APN	4	106401139	missense	probably damaging	0.99
IGL00480:Usp24	APN	4	106368106	missense	probably damaging	0.99
IGL00548:Usp24	APN	4	106341298	missense	probably damaging	0.96
IGL00655:Usp24	APN	4	106390318	missense	probably damaging	0.99
IGL00674:Usp24	APN	4	106372679	splice site	probably benign
IGL00718:Usp24	APN	4	106409704	missense	probably benign	0.10
IGL00803:Usp24	APN	4	106385526	splice site	probably benign
IGL01161:Usp24	APN	4	106436844	missense	probably benign	0.02
IGL01344:Usp24	APN	4	106379385	missense	possibly damaging	0.73
IGL01374:Usp24	APN	4	106380099	missense	possibly damaging	0.86
IGL01485:Usp24	APN	4	106362232	missense	probably benign	0.01
IGL01736:Usp24	APN	4	106423461	missense	probably benign	0.00
IGL01737:Usp24	APN	4	106387734	missense	probably benign	0.03
IGL01862:Usp24	APN	4	106408898	splice site	probably benign
IGL01981:Usp24	APN	4	106375768	splice site	probably benign
IGL02090:Usp24	APN	4	106411426	missense	possibly damaging	0.55
IGL02275:Usp24	APN	4	106387493	missense	probably damaging	1.00
IGL02352:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02359:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02391:Usp24	APN	4	106407129	missense	possibly damaging	0.60
IGL02418:Usp24	APN	4	106436360	missense	probably benign	0.07
IGL02537:Usp24	APN	4	106392367	missense	probably damaging	1.00
IGL02638:Usp24	APN	4	106438770	splice site	probably benign
IGL02638:Usp24	APN	4	106438772	splice site	probably benign
IGL02830:Usp24	APN	4	106347387	missense	possibly damaging	0.79
IGL03125:Usp24	APN	4	106392402	missense	probably benign	0.09
IGL03280:Usp24	APN	4	106380430	missense	probably damaging	1.00
IGL03350:Usp24	APN	4	106371079	nonsense	probably null
BB010:Usp24	UTSW	4	106428489	missense	probably benign
BB020:Usp24	UTSW	4	106428489	missense	probably benign
IGL03098:Usp24	UTSW	4	106371033	missense	probably benign	0.11
R0035:Usp24	UTSW	4	106368027	missense	probably benign	0.18
R0044:Usp24	UTSW	4	106412084	splice site	probably benign
R0086:Usp24	UTSW	4	106392360	missense	probably damaging	0.98
R0125:Usp24	UTSW	4	106397299	missense	possibly damaging	0.76
R0197:Usp24	UTSW	4	106407133	missense	probably damaging	1.00
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0491:Usp24	UTSW	4	106402105	missense	probably benign	0.41
R0687:Usp24	UTSW	4	106420504	missense	probably damaging	1.00
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0973:Usp24	UTSW	4	106413678	splice site	probably null
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106413678	splice site	probably null
R1163:Usp24	UTSW	4	106420960	missense	probably benign
R1293:Usp24	UTSW	4	106423553	missense	probably benign	0.19
R1333:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R1476:Usp24	UTSW	4	106361933	missense	probably damaging	1.00
R1699:Usp24	UTSW	4	106438827	missense	probably damaging	0.99
R1728:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1729:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1753:Usp24	UTSW	4	106377559	missense	probably benign	0.04
R1917:Usp24	UTSW	4	106410286	missense	probably damaging	1.00
R2045:Usp24	UTSW	4	106400980	missense	possibly damaging	0.54
R2424:Usp24	UTSW	4	106399113	critical splice donor site	probably null
R2436:Usp24	UTSW	4	106409645	nonsense	probably null
R2513:Usp24	UTSW	4	106379405	splice site	probably null
R3824:Usp24	UTSW	4	106379066	missense	probably benign
R3831:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3833:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3982:Usp24	UTSW	4	106387883	missense	probably benign	0.38
R4022:Usp24	UTSW	4	106379224	splice site	probably benign
R4067:Usp24	UTSW	4	106359089	missense	possibly damaging	0.68
R4175:Usp24	UTSW	4	106316773	missense	probably benign	0.00
R4766:Usp24	UTSW	4	106416048	missense	probably damaging	1.00
R4771:Usp24	UTSW	4	106362180	splice site	probably null
R4798:Usp24	UTSW	4	106360162	missense	possibly damaging	0.82
R4809:Usp24	UTSW	4	106413676	critical splice donor site	probably null
R4822:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R4906:Usp24	UTSW	4	106388637	missense	probably benign	0.20
R4934:Usp24	UTSW	4	106426546	missense	probably benign	0.29
R5074:Usp24	UTSW	4	106420447	missense	probably benign	0.12
R5151:Usp24	UTSW	4	106399112	critical splice donor site	probably null
R5220:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R5279:Usp24	UTSW	4	106385424	missense	possibly damaging	0.94
R5280:Usp24	UTSW	4	106341214	missense	probably benign	0.18
R5285:Usp24	UTSW	4	106407033	missense	probably benign	0.00
R5292:Usp24	UTSW	4	106418263	missense	probably benign	0.06
R5294:Usp24	UTSW	4	106362357	missense	possibly damaging	0.53
R5394:Usp24	UTSW	4	106408013	missense	probably damaging	1.00
R5517:Usp24	UTSW	4	106375674	missense	probably benign	0.02
R5522:Usp24	UTSW	4	106372721	missense	probably damaging	1.00
R5546:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R5756:Usp24	UTSW	4	106362483	missense	probably damaging	1.00
R5910:Usp24	UTSW	4	106380468	missense	probably damaging	0.99
R5972:Usp24	UTSW	4	106368067	missense	probably damaging	0.98
R6370:Usp24	UTSW	4	106380521	missense	probably null	0.20
R6630:Usp24	UTSW	4	106387835	missense	possibly damaging	0.69
R6754:Usp24	UTSW	4	106360420	missense	probably damaging	1.00
R7027:Usp24	UTSW	4	106362244	missense	probably benign	0.21
R7088:Usp24	UTSW	4	106387546	missense	probably damaging	1.00
R7129:Usp24	UTSW	4	106362215	missense	probably damaging	1.00
R7131:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R7156:Usp24	UTSW	4	106387919	critical splice donor site	probably null
R7174:Usp24	UTSW	4	106362681	splice site	probably null
R7236:Usp24	UTSW	4	106406305	splice site	probably null
R7403:Usp24	UTSW	4	106407035	missense	possibly damaging	0.79
R7424:Usp24	UTSW	4	106379107	missense	probably benign	0.00
R7475:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R7505:Usp24	UTSW	4	106379079	missense	probably damaging	1.00
R7782:Usp24	UTSW	4	106316574	missense	probably damaging	1.00
R7900:Usp24	UTSW	4	106409400	missense	probably damaging	1.00
R7933:Usp24	UTSW	4	106428489	missense	probably benign
R7940:Usp24	UTSW	4	106430544	missense	probably damaging	0.98
R8271:Usp24	UTSW	4	106428514	missense	probably damaging	0.98
R8348:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8448:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8483:Usp24	UTSW	4	106373756	missense	probably damaging	1.00
R8546:Usp24	UTSW	4	106402129	missense	probably benign	0.01
R8798:Usp24	UTSW	4	106379239	missense	probably benign	0.00
R8822:Usp24	UTSW	4	106412213	missense	probably benign	0.17
R8992:Usp24	UTSW	4	106377565	missense	probably benign	0.36
R9002:Usp24	UTSW	4	106418215	missense	possibly damaging	0.72
R9037:Usp24	UTSW	4	106379054	missense	probably damaging	0.99
R9068:Usp24	UTSW	4	106375678	missense	probably benign	0.09
R9096:Usp24	UTSW	4	106397311	missense	probably benign	0.00
R9180:Usp24	UTSW	4	106359050	missense	possibly damaging	0.71
R9199:Usp24	UTSW	4	106387484	missense	probably damaging	1.00
R9201:Usp24	UTSW	4	106420530	missense	probably benign	0.36
R9251:Usp24	UTSW	4	106360518	missense	probably benign	0.19
R9423:Usp24	UTSW	4	106431670	missense	probably damaging	1.00
R9459:Usp24	UTSW	4	106342358	missense	probably damaging	1.00
R9472:Usp24	UTSW	4	106403931	missense	probably benign	0.00
R9483:Usp24	UTSW	4	106362182	missense	probably damaging	0.99
R9534:Usp24	UTSW	4	106407115	missense	probably damaging	0.97
R9653:Usp24	UTSW	4	106347367	missense	probably benign	0.03
R9712:Usp24	UTSW	4	106347367	missense	probably benign	0.03
X0024:Usp24	UTSW	4	106360446	missense	probably benign	0.09
X0028:Usp24	UTSW	4	106368055	missense	probably benign	0.01
X0066:Usp24	UTSW	4	106355731	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GGTTAAAGAAGGTGAGTCCCC -3'
(R):5'- TCAGCAGGCACTCATATGGG -3'

Sequencing Primer
(F):5'- AGGTGAGTCCCCAAGGG -3'
(R):5'- CAGGCACTCATATGGGCATATGTTC -3'

Posted On

2018-03-15