Incidental Mutation 'R6285:Nrd1'
ID508159
Institutional Source Beutler Lab
Gene Symbol Nrd1
Ensembl Gene ENSMUSG00000053510
Gene Namenardilysin, N-arginine dibasic convertase, NRD convertase 1
SynonymsNRD-C
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R6285 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location109000655-109061777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109038006 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 476 (V476F)
Ref Sequence ENSEMBL: ENSMUSP00000068328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065977] [ENSMUST00000102736] [ENSMUST00000106644] [ENSMUST00000125645]
Predicted Effect probably damaging
Transcript: ENSMUST00000065977
AA Change: V476F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068328
Gene: ENSMUSG00000053510
AA Change: V476F

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.1e-43 PFAM
Pfam:Peptidase_M16_C 373 559 2.3e-22 PFAM
Pfam:Peptidase_M16_C 849 1032 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102736
AA Change: V432F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099797
Gene: ENSMUSG00000053510
AA Change: V432F

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.4e-43 PFAM
Pfam:Peptidase_M16_C 400 515 1.1e-9 PFAM
Pfam:Peptidase_M16_C 805 988 2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106644
AA Change: V544F

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102255
Gene: ENSMUSG00000053510
AA Change: V544F

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
coiled coil region 187 225 N/A INTRINSIC
Pfam:Peptidase_M16 281 416 1e-41 PFAM
Pfam:Peptidase_M16_C 441 627 2.2e-23 PFAM
Pfam:Peptidase_M16_M 631 913 1e-91 PFAM
Pfam:Peptidase_M16_C 917 1100 6e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125645
AA Change: V228F

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122808
Gene: ENSMUSG00000053510
AA Change: V228F

DomainStartEndE-ValueType
Pfam:Peptidase_M16 1 100 6.4e-27 PFAM
Pfam:Peptidase_M16_C 125 311 1.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150784
Meta Mutation Damage Score 0.8304 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent endopeptidase that cleaves peptide substrates at the N-terminus of arginine residues in dibasic moieties and is a member of the peptidase M16 family. This protein interacts with heparin-binding EGF-like growth factor and plays a role in cell migration and proliferation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele mostly die within 48 hours of birth with surviving mice exhibiting cortical thinning, enlarged lateral ventricles, hypomyelination, reduced grip strength, impaired coordination, and impaired spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,072,224 K28R probably benign Het
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cd79a A G 7: 24,899,347 N107S possibly damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dennd1a A T 2: 37,852,441 H437Q possibly damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Golga4 C T 9: 118,558,627 R616* probably null Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hipk3 T C 2: 104,471,425 M141V probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Kcp C A 6: 29,502,365 V227L probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pcdhgc5 A T 18: 37,820,621 Y316F probably benign Het
Pecam1 T C 11: 106,685,239 D490G probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Ppp2r5b T A 19: 6,230,536 Q304L probably benign Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptk6 A T 2: 181,197,093 L289Q probably null Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sept8 G T 11: 53,534,767 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Tbx6 A G 7: 126,781,568 Q21R possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in Nrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Nrd1 APN 4 109046687 unclassified probably benign
IGL00857:Nrd1 APN 4 109054002 missense probably damaging 1.00
IGL01417:Nrd1 APN 4 109000830 utr 5 prime probably benign
IGL01457:Nrd1 APN 4 109047660 missense probably benign 0.03
IGL02112:Nrd1 APN 4 109027432 splice site probably benign
IGL02279:Nrd1 APN 4 109024194 splice site probably benign
IGL02332:Nrd1 APN 4 109000988 missense probably damaging 0.99
IGL02890:Nrd1 APN 4 109053919 missense possibly damaging 0.55
IGL03179:Nrd1 APN 4 109046691 unclassified probably benign
PIT4354001:Nrd1 UTSW 4 109054025 critical splice donor site probably null
R0551:Nrd1 UTSW 4 109047708 missense probably damaging 1.00
R1468:Nrd1 UTSW 4 109016668 missense probably benign 0.01
R1468:Nrd1 UTSW 4 109016668 missense probably benign 0.01
R1990:Nrd1 UTSW 4 109039775 nonsense probably null
R4391:Nrd1 UTSW 4 109046644 missense probably damaging 1.00
R4994:Nrd1 UTSW 4 109046612 missense probably benign
R5164:Nrd1 UTSW 4 109039717 missense probably damaging 0.99
R5229:Nrd1 UTSW 4 109049108 missense probably damaging 1.00
R5387:Nrd1 UTSW 4 109039762 missense probably damaging 1.00
R5530:Nrd1 UTSW 4 109047609 missense probably damaging 0.96
R5672:Nrd1 UTSW 4 109038045 nonsense probably null
R5990:Nrd1 UTSW 4 109019071 missense probably damaging 1.00
R6018:Nrd1 UTSW 4 109013747 missense probably benign 0.01
R6106:Nrd1 UTSW 4 109044585 missense probably damaging 0.99
R6114:Nrd1 UTSW 4 109044585 missense probably damaging 0.99
R6140:Nrd1 UTSW 4 109049111 missense probably damaging 0.97
R6824:Nrd1 UTSW 4 109043425 missense probably damaging 1.00
R7019:Nrd1 UTSW 4 109028802 missense probably benign 0.33
R7353:Nrd1 UTSW 4 109039749 missense probably damaging 1.00
R7735:Nrd1 UTSW 4 109037985 missense probably damaging 1.00
R8261:Nrd1 UTSW 4 109016679 missense possibly damaging 0.67
R8340:Nrd1 UTSW 4 109001154 missense probably damaging 1.00
R8352:Nrd1 UTSW 4 109019063 missense probably damaging 0.98
R8368:Nrd1 UTSW 4 109013698 missense probably benign 0.02
R8452:Nrd1 UTSW 4 109019063 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACGCCTCTTTCCTGTAAAAG -3'
(R):5'- GAGCCACCGCATTAAAATAACTGAG -3'

Sequencing Primer
(F):5'- AGTGAGCTTACATGAAATGTCTTATC -3'
(R):5'- CAGCTCTATGGTTAAGAGCACTG -3'
Posted On2018-03-15