Incidental Mutation 'R6285:Kcp'
ID508168
Institutional Source Beutler Lab
Gene Symbol Kcp
Ensembl Gene ENSMUSG00000059022
Gene Namekielin/chordin-like protein
SynonymsCrim2, KCP, LOC333088
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6285 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location29473162-29507952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 29502365 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 227 (V227L)
Ref Sequence ENSEMBL: ENSMUSP00000088954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000161237]
Predicted Effect probably benign
Transcript: ENSMUST00000078112
AA Change: V227L

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022
AA Change: V227L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
Pfam:VWD 1214 1254 4.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091391
AA Change: V227L

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022
AA Change: V227L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1082 6.53e-9 SMART
VWC 1089 1142 1.05e-3 SMART
VWC 1149 1206 2.93e-11 SMART
Pfam:VWD 1213 1253 4.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101614
AA Change: V227L

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: V227L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 8e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
VWD 1201 1362 6.09e-50 SMART
C8 1404 1479 1.55e-34 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160181
AA Change: V50L
SMART Domains Protein: ENSMUSP00000125699
Gene: ENSMUSG00000059022
AA Change: V50L

DomainStartEndE-ValueType
VWC 18 74 1.24e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161237
SMART Domains Protein: ENSMUSP00000124097
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
coiled coil region 60 92 N/A INTRINSIC
internal_repeat_1 94 117 8.56e-6 PROSPERO
internal_repeat_1 136 159 8.56e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162959
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,072,224 K28R probably benign Het
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cd79a A G 7: 24,899,347 N107S possibly damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dennd1a A T 2: 37,852,441 H437Q possibly damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Golga4 C T 9: 118,558,627 R616* probably null Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hipk3 T C 2: 104,471,425 M141V probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Nrd1 G T 4: 109,038,006 V476F probably damaging Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pcdhgc5 A T 18: 37,820,621 Y316F probably benign Het
Pecam1 T C 11: 106,685,239 D490G probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Ppp2r5b T A 19: 6,230,536 Q304L probably benign Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptk6 A T 2: 181,197,093 L289Q probably null Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sept8 G T 11: 53,534,767 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Tbx6 A G 7: 126,781,568 Q21R possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in Kcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Kcp APN 6 29482657 missense probably benign
IGL01344:Kcp APN 6 29498951 splice site probably null
IGL01404:Kcp APN 6 29496639 missense probably damaging 0.99
IGL01735:Kcp APN 6 29498879 missense probably damaging 1.00
IGL01776:Kcp APN 6 29497908 missense probably damaging 1.00
IGL02092:Kcp APN 6 29489032 critical splice donor site probably null
IGL02252:Kcp APN 6 29504549 missense probably damaging 1.00
IGL02690:Kcp APN 6 29484999 unclassified probably benign
IGL02817:Kcp APN 6 29496969 missense probably damaging 0.97
IGL03074:Kcp APN 6 29496631 missense probably damaging 1.00
P0045:Kcp UTSW 6 29498348 missense probably damaging 1.00
R0219:Kcp UTSW 6 29495785 missense probably damaging 1.00
R0355:Kcp UTSW 6 29496927 missense possibly damaging 0.89
R0738:Kcp UTSW 6 29490439 missense probably benign 0.24
R1111:Kcp UTSW 6 29485423 missense probably benign
R1304:Kcp UTSW 6 29501292 unclassified probably benign
R1663:Kcp UTSW 6 29498965 missense possibly damaging 0.68
R1808:Kcp UTSW 6 29505655 missense probably benign 0.05
R1907:Kcp UTSW 6 29497835 unclassified probably benign
R2030:Kcp UTSW 6 29489072 missense probably damaging 1.00
R2099:Kcp UTSW 6 29496165 nonsense probably null
R3411:Kcp UTSW 6 29482846 missense possibly damaging 0.68
R3982:Kcp UTSW 6 29484637 missense probably damaging 1.00
R3983:Kcp UTSW 6 29484637 missense probably damaging 1.00
R4223:Kcp UTSW 6 29482258 missense possibly damaging 0.55
R4377:Kcp UTSW 6 29493203 missense probably damaging 1.00
R4570:Kcp UTSW 6 29491848 nonsense probably null
R4624:Kcp UTSW 6 29482814 missense possibly damaging 0.94
R4694:Kcp UTSW 6 29493197 missense probably benign 0.29
R4750:Kcp UTSW 6 29484626 missense probably benign 0.03
R4968:Kcp UTSW 6 29497629 nonsense probably null
R5053:Kcp UTSW 6 29496958 missense probably benign 0.01
R5067:Kcp UTSW 6 29492108 missense probably benign 0.06
R5253:Kcp UTSW 6 29498520 unclassified probably benign
R5418:Kcp UTSW 6 29504284 nonsense probably null
R6020:Kcp UTSW 6 29502864 missense probably benign 0.03
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6088:Kcp UTSW 6 29502632 missense probably benign
R6178:Kcp UTSW 6 29482888 missense possibly damaging 0.68
R6310:Kcp UTSW 6 29493258 missense probably damaging 0.98
R6369:Kcp UTSW 6 29484694 missense probably damaging 1.00
R6860:Kcp UTSW 6 29505720 missense probably benign 0.19
R6949:Kcp UTSW 6 29484612 splice site probably null
R6962:Kcp UTSW 6 29482840 missense probably benign 0.08
R7006:Kcp UTSW 6 29499170 missense probably damaging 1.00
R7138:Kcp UTSW 6 29491862 nonsense probably null
R7141:Kcp UTSW 6 29487512 nonsense probably null
R7153:Kcp UTSW 6 29499015 missense probably damaging 1.00
R7162:Kcp UTSW 6 29497200 intron probably null
R7334:Kcp UTSW 6 29485512 missense probably damaging 1.00
R7565:Kcp UTSW 6 29499187 missense probably damaging 1.00
R7671:Kcp UTSW 6 29496517 missense probably benign 0.02
R7766:Kcp UTSW 6 29496847 missense probably damaging 0.98
R7781:Kcp UTSW 6 29497765 missense probably damaging 1.00
Z1176:Kcp UTSW 6 29485012 missense probably benign 0.23
Z1177:Kcp UTSW 6 29485525 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ACCGATCAAACATCAGTCTGG -3'
(R):5'- TGTCCAGTTCCAACCCATGC -3'

Sequencing Primer
(F):5'- CTCTTCCAGAAGACATGAGTTCG -3'
(R):5'- CCAGTGCTCTTGCCTGGTG -3'
Posted On2018-03-15