Incidental Mutation 'R6285:Cd79a'
ID508173
Institutional Source Beutler Lab
Gene Symbol Cd79a
Ensembl Gene ENSMUSG00000003379
Gene NameCD79A antigen (immunoglobulin-associated alpha)
SynonymsCd79a, Ig alpha, Iga, Igalpha, Ig-alpha, Ly54, Ly-54, mb-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6285 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24897381-24902197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24899347 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 107 (N107S)
Ref Sequence ENSEMBL: ENSMUSP00000003469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003469] [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117796] [ENSMUST00000206028] [ENSMUST00000206508]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003469
AA Change: N107S

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000003469
Gene: ENSMUSG00000003379
AA Change: N107S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 35 120 9.18e-12 SMART
transmembrane domain 138 160 N/A INTRINSIC
ITAM 179 199 4.19e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047873
SMART Domains Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098683
SMART Domains Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 2.2e-78 PFAM
PDB:3ODW|B 238 384 2e-57 PDB
low complexity region 396 412 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
RhoGEF 478 662 1.87e-63 SMART
PH 706 820 4.68e-5 SMART
low complexity region 904 923 N/A INTRINSIC
coiled coil region 926 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117796
SMART Domains Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 7.3e-73 PFAM
low complexity region 393 409 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
RhoGEF 475 659 1.87e-63 SMART
PH 703 817 4.68e-5 SMART
low complexity region 901 920 N/A INTRINSIC
coiled coil region 923 946 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129383
Predicted Effect probably benign
Transcript: ENSMUST00000206028
Predicted Effect probably benign
Transcript: ENSMUST00000206508
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-alpha protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of B cells at the pro-B cell stage due to diminished signaling of the B cell receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,072,224 K28R probably benign Het
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dennd1a A T 2: 37,852,441 H437Q possibly damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Golga4 C T 9: 118,558,627 R616* probably null Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hipk3 T C 2: 104,471,425 M141V probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Kcp C A 6: 29,502,365 V227L probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Nrd1 G T 4: 109,038,006 V476F probably damaging Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pcdhgc5 A T 18: 37,820,621 Y316F probably benign Het
Pecam1 T C 11: 106,685,239 D490G probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Ppp2r5b T A 19: 6,230,536 Q304L probably benign Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptk6 A T 2: 181,197,093 L289Q probably null Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sept8 G T 11: 53,534,767 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Tbx6 A G 7: 126,781,568 Q21R possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in Cd79a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:Cd79a APN 7 24901266 missense probably benign 0.01
IGL03302:Cd79a APN 7 24899334 missense probably damaging 1.00
crab UTSW 7 24899175 missense probably damaging 1.00
elementary UTSW 7 24899262 missense probably damaging 1.00
holmes UTSW 7 24897546 nonsense probably null
R1692:Cd79a UTSW 7 24901456 missense probably damaging 1.00
R2038:Cd79a UTSW 7 24899357 missense probably benign 0.43
R5450:Cd79a UTSW 7 24899262 missense probably damaging 1.00
R7420:Cd79a UTSW 7 24897546 nonsense probably null
R7459:Cd79a UTSW 7 24899142 missense possibly damaging 0.94
R7751:Cd79a UTSW 7 24899667 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCTGTGAAAACAATGGCAGG -3'
(R):5'- TAGGGACTGGATCTGTGAAGAC -3'

Sequencing Primer
(F):5'- GGAACCCTAATATCACATGGTGGTTC -3'
(R):5'- TGAAGACAGGGTGCTGCTC -3'
Posted On2018-03-15