Mutagenetix > Incidental Mutation

Incidental Mutation 'R6285:Igf1r'

508176

Institutional Source

Beutler Lab

Gene Symbol

Igf1r

Ensembl Gene

ENSMUSG00000005533

Gene Name

insulin-like growth factor I receptor

Synonyms

line 186, A330103N21Rik, CD221, hyft, IGF-1R

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6285 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67952827-68233668 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 68004137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 141 (I141S)

Ref Sequence

ENSEMBL: ENSMUSP00000005671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005671]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005671
AA Change: I141S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: I141S

Domain	Start	End	E-Value	Type
Pfam:Recep_L_domain	51	161	1.6e-29	PFAM
FU	227	270	2.98e-12	SMART
Pfam:Recep_L_domain	353	467	3.8e-32	PFAM
FN3	490	593	4.67e-2	SMART
FN3	612	815	1.95e-4	SMART
FN3	833	915	7.4e-5	SMART
low complexity region	937	954	N/A	INTRINSIC
TyrKc	1000	1268	8.51e-141	SMART
low complexity region	1285	1303	N/A	INTRINSIC
low complexity region	1306	1319	N/A	INTRINSIC

Meta Mutation Damage Score

0.9122

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.8%
20x: 96.9%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	A	G	18: 59,072,224	K28R	probably benign	Het
Acad9	A	T	3: 36,082,175	M370L	probably benign	Het
Aimp1	A	G	3: 132,667,504	M225T	possibly damaging	Het
Atp8a1	T	C	5: 67,667,607	I809V	possibly damaging	Het
Bbs10	A	G	10: 111,299,761	Y245C	probably damaging	Het
Cabin1	A	T	10: 75,684,323	F1572Y	probably damaging	Het
Cd79a	A	G	7: 24,899,347	N107S	possibly damaging	Het
Cdc7	G	A	5: 106,983,059	A428T	probably benign	Het
Cep290	A	G	10: 100,523,329	T974A	probably benign	Het
Cep350	A	T	1: 155,953,374	N261K	possibly damaging	Het
Cfap46	T	A	7: 139,661,085	D8V	probably damaging	Het
Col6a4	T	C	9: 106,074,986	D571G	probably damaging	Het
Cpe	A	C	8: 64,617,611	V200G	probably benign	Het
Ctnnd1	C	T	2: 84,613,887		probably null	Het
D5Ertd579e	A	C	5: 36,615,577	C491W	probably damaging	Het
Dek	A	G	13: 47,099,380	I183T	probably damaging	Het
Dennd1a	A	T	2: 37,852,441	H437Q	possibly damaging	Het
Dido1	C	T	2: 180,661,147	A1655T	probably benign	Het
Eva1b	A	G	4: 126,149,485	D106G	probably damaging	Het
Evc2	G	T	5: 37,424,579	S1189I	possibly damaging	Het
Faap100	A	T	11: 120,376,732	L405Q	probably damaging	Het
Fbxw15	T	A	9: 109,557,166	M249L	probably benign	Het
Gbp10	A	T	5: 105,218,460	L526Q	probably damaging	Het
Gm13084	A	G	4: 143,816,039	C4R	probably damaging	Het
Gm14025	T	G	2: 129,037,799	T736P	possibly damaging	Het
Gm19402	A	C	10: 77,690,520		probably benign	Het
Gm2244	A	G	14: 19,540,797	Y141H	probably damaging	Het
Gm4181	A	T	14: 51,633,209	N98K	probably damaging	Het
Gm765	T	C	6: 98,238,173	D163G	probably damaging	Het
Golga4	C	T	9: 118,558,627	R616*	probably null	Het
Gpank1	T	A	17: 35,124,290	S226T	probably damaging	Het
Hipk3	T	C	2: 104,471,425	M141V	probably damaging	Het
Hoxc11	T	C	15: 102,954,743	V73A	probably benign	Het
Jak2	T	A	19: 29,295,659	F628I	probably benign	Het
Kcp	C	A	6: 29,502,365	V227L	probably benign	Het
Knl1	T	G	2: 119,071,941	C1374W	probably damaging	Het
Larp6	A	T	9: 60,737,760	R394S	probably benign	Het
Lilra5	G	A	7: 4,242,115	G253R	probably damaging	Het
Map3k4	A	G	17: 12,264,058	S591P	probably damaging	Het
Mrpl16	T	A	19: 11,772,968	I72K	probably damaging	Het
Nol11	C	G	11: 107,181,034	R244S	probably benign	Het
Nr2f1	T	C	13: 78,195,663	T161A	probably benign	Het
Nrd1	G	T	4: 109,038,006	V476F	probably damaging	Het
Olfr1406	G	T	1: 173,183,910	H175N	probably damaging	Het
Olfr419	A	T	1: 174,250,829	S33T	possibly damaging	Het
Olfr451-ps1	A	T	6: 42,800,909	H56L	probably benign	Het
Olfr535	T	A	7: 140,492,713	L25Q	possibly damaging	Het
P2rx1	A	G	11: 73,008,148	I62V	probably benign	Het
Pcdhgc5	A	T	18: 37,820,621	Y316F	probably benign	Het
Pecam1	T	C	11: 106,685,239	D490G	probably benign	Het
Pfkfb2	A	T	1: 130,707,562	Y87*	probably null	Het
Poldip2	A	G	11: 78,517,632		probably null	Het
Ppp2r5b	T	A	19: 6,230,536	Q304L	probably benign	Het
Psg26	A	G	7: 18,482,828	F29L	probably benign	Het
Ptk6	A	T	2: 181,197,093	L289Q	probably null	Het
Ptprt	A	T	2: 161,901,497	I508N	possibly damaging	Het
Rasgrp4	T	C	7: 29,148,383	F406S	probably damaging	Het
Rspo3	A	G	10: 29,499,930		probably null	Het
Sept8	G	T	11: 53,534,767		probably null	Het
Sirt2	A	C	7: 28,788,046	T345P	probably benign	Het
Slc6a20b	T	C	9: 123,609,096	E205G	possibly damaging	Het
Sqstm1	G	A	11: 50,202,591	Q327*	probably null	Het
Susd3	T	A	13: 49,237,521	S98C	probably damaging	Het
Tada2b	G	A	5: 36,476,842	R56W	probably damaging	Het
Tbc1d2	A	T	4: 46,615,045	V546E	possibly damaging	Het
Tbx6	A	G	7: 126,781,568	Q21R	possibly damaging	Het
Usp24	T	G	4: 106,374,100		probably null	Het
Vmn2r103	A	G	17: 19,812,144	T727A	probably benign	Het
Wdr48	C	T	9: 119,920,610	T531M	probably damaging	Het

Other mutations in Igf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Igf1r	APN	7	68190023	missense	probably benign
IGL00837:Igf1r	APN	7	68201352	splice site	probably benign
IGL01515:Igf1r	APN	7	68207452	missense	probably damaging	1.00
IGL01572:Igf1r	APN	7	68193441	missense	probably benign	0.01
IGL02100:Igf1r	APN	7	68189958	missense	probably benign	0.05
IGL02506:Igf1r	APN	7	68193396	missense	probably benign
IGL02672:Igf1r	APN	7	68190033	missense	probably benign	0.05
IGL02701:Igf1r	APN	7	68201249	missense	possibly damaging	0.93
IGL02742:Igf1r	APN	7	68189991	missense	possibly damaging	0.94
IGL03073:Igf1r	APN	7	68215043	missense	probably damaging	1.00
IGL03257:Igf1r	APN	7	68214940	missense	probably damaging	1.00
Frufru	UTSW	7	68004163	missense	probably damaging	1.00
Hungarian	UTSW	7	68214997	missense	probably damaging	1.00
Mimi	UTSW	7	68195026	missense	possibly damaging	0.67
Piroshka	UTSW	7	68207336	nonsense	probably null
Romanian	UTSW	7	68004137	missense	possibly damaging	0.94
Sublime	UTSW	7	68004179	missense	probably damaging	1.00
Toy	UTSW	7	68003972	missense	probably damaging	1.00
BB009:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
BB019:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
FR4548:Igf1r	UTSW	7	68226186	small insertion	probably benign
FR4737:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226186	small insertion	probably benign
PIT4445001:Igf1r	UTSW	7	68207463	missense	probably damaging	1.00
R0003:Igf1r	UTSW	7	68165242	missense	probably damaging	1.00
R0184:Igf1r	UTSW	7	68226193	missense	possibly damaging	0.84
R0538:Igf1r	UTSW	7	68207826	missense	probably damaging	1.00
R0632:Igf1r	UTSW	7	68165155	missense	probably damaging	1.00
R0727:Igf1r	UTSW	7	68212158	critical splice donor site	probably null
R0750:Igf1r	UTSW	7	68212091	missense	probably damaging	0.99
R1104:Igf1r	UTSW	7	68195026	missense	possibly damaging	0.67
R1169:Igf1r	UTSW	7	68165127	missense	probably benign	0.00
R1348:Igf1r	UTSW	7	68218468	missense	probably damaging	1.00
R1471:Igf1r	UTSW	7	68003837	missense	probably damaging	0.98
R1580:Igf1r	UTSW	7	68207869	missense	probably benign
R1745:Igf1r	UTSW	7	68169913	missense	probably damaging	1.00
R1772:Igf1r	UTSW	7	68195074	missense	probably benign	0.03
R1789:Igf1r	UTSW	7	68214933	nonsense	probably null
R1823:Igf1r	UTSW	7	68194981	missense	possibly damaging	0.77
R1902:Igf1r	UTSW	7	68201249	missense	possibly damaging	0.93
R1962:Igf1r	UTSW	7	68207275	missense	probably damaging	0.99
R2179:Igf1r	UTSW	7	68003950	missense	probably damaging	0.99
R2215:Igf1r	UTSW	7	68165234	missense	probably benign
R2221:Igf1r	UTSW	7	68201962	missense	probably damaging	1.00
R2233:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2234:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2235:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R3023:Igf1r	UTSW	7	68183399	missense	probably benign	0.00
R4044:Igf1r	UTSW	7	68190062	missense	possibly damaging	0.83
R4226:Igf1r	UTSW	7	68195078	nonsense	probably null
R4387:Igf1r	UTSW	7	68170009	missense	probably benign
R4388:Igf1r	UTSW	7	68170009	missense	probably benign
R4728:Igf1r	UTSW	7	68189624	missense	probably damaging	1.00
R4781:Igf1r	UTSW	7	68165199	missense	possibly damaging	0.75
R5254:Igf1r	UTSW	7	68207319	missense	probably damaging	0.99
R5278:Igf1r	UTSW	7	68193418	missense	possibly damaging	0.78
R5510:Igf1r	UTSW	7	68193359	missense	probably benign	0.19
R5522:Igf1r	UTSW	7	68183510	missense	probably damaging	0.96
R5527:Igf1r	UTSW	7	68207821	missense	probably damaging	1.00
R5761:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R5849:Igf1r	UTSW	7	68190033	missense	probably benign
R6189:Igf1r	UTSW	7	68207336	nonsense	probably null
R6262:Igf1r	UTSW	7	68003972	missense	probably damaging	1.00
R6318:Igf1r	UTSW	7	68165233	missense	probably benign	0.02
R6365:Igf1r	UTSW	7	68190050	missense	probably benign	0.26
R6377:Igf1r	UTSW	7	68201250	missense	probably benign	0.00
R6831:Igf1r	UTSW	7	68207319	missense	possibly damaging	0.75
R6848:Igf1r	UTSW	7	68004179	missense	probably damaging	1.00
R6902:Igf1r	UTSW	7	68004163	missense	probably damaging	1.00
R7193:Igf1r	UTSW	7	68187157	missense	probably damaging	1.00
R7373:Igf1r	UTSW	7	68195078	nonsense	probably null
R7442:Igf1r	UTSW	7	68173278	missense	probably damaging	1.00
R7903:Igf1r	UTSW	7	68184752	missense	probably damaging	1.00
R7923:Igf1r	UTSW	7	68190101	missense	probably damaging	1.00
R7932:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
R8368:Igf1r	UTSW	7	68187048	missense	probably benign	0.03
R8458:Igf1r	UTSW	7	68195629	missense	probably benign
R8539:Igf1r	UTSW	7	68003848	missense	probably benign	0.06
R8704:Igf1r	UTSW	7	68170054	splice site	probably benign
R8746:Igf1r	UTSW	7	68214997	missense	probably damaging	1.00
R8829:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8832:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8859:Igf1r	UTSW	7	68183463	missense	possibly damaging	0.75
R9057:Igf1r	UTSW	7	68183438	missense	probably damaging	1.00
R9243:Igf1r	UTSW	7	68212027	missense	probably benign	0.11
R9342:Igf1r	UTSW	7	68194998	missense	probably benign	0.00
R9412:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R9525:Igf1r	UTSW	7	68214934	missense	probably damaging	1.00
R9727:Igf1r	UTSW	7	68207806	missense	probably damaging	1.00
R9730:Igf1r	UTSW	7	68189675	missense	probably damaging	1.00
R9779:Igf1r	UTSW	7	68004317	missense	probably damaging	1.00
RF025:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF032:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF034:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF037:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF039:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF044:Igf1r	UTSW	7	68226179	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226168	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226174	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226180	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226182	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226170	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226173	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226169	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTCACCGTCATCACTGAGTAC -3'
(R):5'- AGCGATTTGTGGTCCAGCAG -3'

Sequencing Primer
(F):5'- ACCGTCATCACTGAGTACTTGCTG -3'
(R):5'- TCCAGCAGCGGTAGTTGTACTC -3'

Posted On

2018-03-15