Mutagenetix > Incidental Mutation

Incidental Mutation 'R6285:Tbx6'

508177

Institutional Source

Beutler Lab

Gene Symbol

Tbx6

Ensembl Gene

ENSMUSG00000030699

Gene Name

T-box 6

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6285 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126781483-126785560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126781568 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 21 (Q21R)

Ref Sequence

ENSEMBL: ENSMUSP00000126418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032936] [ENSMUST00000038614] [ENSMUST00000094037] [ENSMUST00000106356] [ENSMUST00000106357] [ENSMUST00000106359] [ENSMUST00000132643] [ENSMUST00000145762] [ENSMUST00000170882] [ENSMUST00000172352] [ENSMUST00000206570] [ENSMUST00000205935] [ENSMUST00000205786]

AlphaFold

P70327

Predicted Effect

probably benign
Transcript: ENSMUST00000032936

SMART Domains

Protein: ENSMUSP00000032936
Gene: ENSMUSG00000030697

Domain	Start	End	E-Value	Type
PP2Ac	20	290	4.04e-147	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000038614

SMART Domains

Protein: ENSMUSP00000037332
Gene: ENSMUSG00000042675

Domain	Start	End	E-Value	Type
Pfam:Yippee-Mis18	20	114	6.8e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000068836

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094037
AA Change: Q21R

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000091579
Gene: ENSMUSG00000030699
AA Change: Q21R

Domain	Start	End	E-Value	Type
low complexity region	55	75	N/A	INTRINSIC
TBOX	90	278	1.79e-128	SMART
low complexity region	332	348	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106356

SMART Domains

Protein: ENSMUSP00000101963
Gene: ENSMUSG00000042675

Domain	Start	End	E-Value	Type
Pfam:Yippee-Mis18	20	114	5.4e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106357

SMART Domains

Protein: ENSMUSP00000101964
Gene: ENSMUSG00000042675

Domain	Start	End	E-Value	Type
Pfam:Yippee-Mis18	20	114	5.4e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106359

Predicted Effect

probably benign
Transcript: ENSMUST00000132643

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143078

Predicted Effect

probably benign
Transcript: ENSMUST00000145762

SMART Domains

Protein: ENSMUSP00000115596
Gene: ENSMUSG00000042675

Domain	Start	End	E-Value	Type
Pfam:Yippee-Mis18	20	103	2.5e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156891

Predicted Effect

probably benign
Transcript: ENSMUST00000170882

SMART Domains

Protein: ENSMUSP00000128753
Gene: ENSMUSG00000042675

Domain	Start	End	E-Value	Type
Pfam:Yippee-Mis18	20	114	5.4e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172352
AA Change: Q21R

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126418
Gene: ENSMUSG00000030699
AA Change: Q21R

Domain	Start	End	E-Value	Type
low complexity region	55	75	N/A	INTRINSIC
TBOX	90	278	1.79e-128	SMART
low complexity region	333	349	N/A	INTRINSIC
low complexity region	415	429	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205660

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206143

Predicted Effect

probably benign
Transcript: ENSMUST00000206570

Predicted Effect

probably benign
Transcript: ENSMUST00000205935

Predicted Effect

probably benign
Transcript: ENSMUST00000206477

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206903

Predicted Effect

probably benign
Transcript: ENSMUST00000205786

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.8%
20x: 96.9%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. Knockout studies in mice indicate that this gene is important for specification of paraxial mesoderm structures. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null embryos die during organogenesis exhibiting defects in paraxial mesoderm differentiation, ectopic neural tube development, kinked neural tubes, impaired somite development, hematomas, enlarged tail buds, and laterality defects associated with nodal cilium anomalies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	A	G	18: 59,072,224	K28R	probably benign	Het
Acad9	A	T	3: 36,082,175	M370L	probably benign	Het
Aimp1	A	G	3: 132,667,504	M225T	possibly damaging	Het
Atp8a1	T	C	5: 67,667,607	I809V	possibly damaging	Het
Bbs10	A	G	10: 111,299,761	Y245C	probably damaging	Het
Cabin1	A	T	10: 75,684,323	F1572Y	probably damaging	Het
Cd79a	A	G	7: 24,899,347	N107S	possibly damaging	Het
Cdc7	G	A	5: 106,983,059	A428T	probably benign	Het
Cep290	A	G	10: 100,523,329	T974A	probably benign	Het
Cep350	A	T	1: 155,953,374	N261K	possibly damaging	Het
Cfap46	T	A	7: 139,661,085	D8V	probably damaging	Het
Col6a4	T	C	9: 106,074,986	D571G	probably damaging	Het
Cpe	A	C	8: 64,617,611	V200G	probably benign	Het
Ctnnd1	C	T	2: 84,613,887		probably null	Het
D5Ertd579e	A	C	5: 36,615,577	C491W	probably damaging	Het
Dek	A	G	13: 47,099,380	I183T	probably damaging	Het
Dennd1a	A	T	2: 37,852,441	H437Q	possibly damaging	Het
Dido1	C	T	2: 180,661,147	A1655T	probably benign	Het
Eva1b	A	G	4: 126,149,485	D106G	probably damaging	Het
Evc2	G	T	5: 37,424,579	S1189I	possibly damaging	Het
Faap100	A	T	11: 120,376,732	L405Q	probably damaging	Het
Fbxw15	T	A	9: 109,557,166	M249L	probably benign	Het
Gbp10	A	T	5: 105,218,460	L526Q	probably damaging	Het
Gm13084	A	G	4: 143,816,039	C4R	probably damaging	Het
Gm14025	T	G	2: 129,037,799	T736P	possibly damaging	Het
Gm19402	A	C	10: 77,690,520		probably benign	Het
Gm2244	A	G	14: 19,540,797	Y141H	probably damaging	Het
Gm4181	A	T	14: 51,633,209	N98K	probably damaging	Het
Gm765	T	C	6: 98,238,173	D163G	probably damaging	Het
Golga4	C	T	9: 118,558,627	R616*	probably null	Het
Gpank1	T	A	17: 35,124,290	S226T	probably damaging	Het
Hipk3	T	C	2: 104,471,425	M141V	probably damaging	Het
Hoxc11	T	C	15: 102,954,743	V73A	probably benign	Het
Igf1r	T	G	7: 68,004,137	I141S	possibly damaging	Het
Jak2	T	A	19: 29,295,659	F628I	probably benign	Het
Kcp	C	A	6: 29,502,365	V227L	probably benign	Het
Knl1	T	G	2: 119,071,941	C1374W	probably damaging	Het
Larp6	A	T	9: 60,737,760	R394S	probably benign	Het
Lilra5	G	A	7: 4,242,115	G253R	probably damaging	Het
Map3k4	A	G	17: 12,264,058	S591P	probably damaging	Het
Mrpl16	T	A	19: 11,772,968	I72K	probably damaging	Het
Nol11	C	G	11: 107,181,034	R244S	probably benign	Het
Nr2f1	T	C	13: 78,195,663	T161A	probably benign	Het
Nrd1	G	T	4: 109,038,006	V476F	probably damaging	Het
Olfr1406	G	T	1: 173,183,910	H175N	probably damaging	Het
Olfr419	A	T	1: 174,250,829	S33T	possibly damaging	Het
Olfr451-ps1	A	T	6: 42,800,909	H56L	probably benign	Het
Olfr535	T	A	7: 140,492,713	L25Q	possibly damaging	Het
P2rx1	A	G	11: 73,008,148	I62V	probably benign	Het
Pcdhgc5	A	T	18: 37,820,621	Y316F	probably benign	Het
Pecam1	T	C	11: 106,685,239	D490G	probably benign	Het
Pfkfb2	A	T	1: 130,707,562	Y87*	probably null	Het
Poldip2	A	G	11: 78,517,632		probably null	Het
Ppp2r5b	T	A	19: 6,230,536	Q304L	probably benign	Het
Psg26	A	G	7: 18,482,828	F29L	probably benign	Het
Ptk6	A	T	2: 181,197,093	L289Q	probably null	Het
Ptprt	A	T	2: 161,901,497	I508N	possibly damaging	Het
Rasgrp4	T	C	7: 29,148,383	F406S	probably damaging	Het
Rspo3	A	G	10: 29,499,930		probably null	Het
Sept8	G	T	11: 53,534,767		probably null	Het
Sirt2	A	C	7: 28,788,046	T345P	probably benign	Het
Slc6a20b	T	C	9: 123,609,096	E205G	possibly damaging	Het
Sqstm1	G	A	11: 50,202,591	Q327*	probably null	Het
Susd3	T	A	13: 49,237,521	S98C	probably damaging	Het
Tada2b	G	A	5: 36,476,842	R56W	probably damaging	Het
Tbc1d2	A	T	4: 46,615,045	V546E	possibly damaging	Het
Usp24	T	G	4: 106,374,100		probably null	Het
Vmn2r103	A	G	17: 19,812,144	T727A	probably benign	Het
Wdr48	C	T	9: 119,920,610	T531M	probably damaging	Het

Other mutations in Tbx6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Tbx6	APN	7	126781529	missense	probably damaging	1.00
IGL01899:Tbx6	APN	7	126784532	unclassified	probably benign
R1018:Tbx6	UTSW	7	126783192	unclassified	probably benign
R1126:Tbx6	UTSW	7	126784719	missense	probably damaging	1.00
R2045:Tbx6	UTSW	7	126782883	missense	probably damaging	1.00
R4913:Tbx6	UTSW	7	126784535	critical splice acceptor site	probably null
R5251:Tbx6	UTSW	7	126783344	missense	probably damaging	1.00
R5926:Tbx6	UTSW	7	126784853	missense	possibly damaging	0.53
R5927:Tbx6	UTSW	7	126784853	missense	possibly damaging	0.53
R7072:Tbx6	UTSW	7	126784740	missense	probably benign	0.37
R8023:Tbx6	UTSW	7	126782859	missense	possibly damaging	0.88
R8544:Tbx6	UTSW	7	126781484	splice site	probably null
R9046:Tbx6	UTSW	7	126781948	critical splice donor site	probably null
R9102:Tbx6	UTSW	7	126781842	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CCTAGGGATCAATCAGACCGAG -3'
(R):5'- CGATCCCAGAGAGGAAGCAATC -3'

Sequencing Primer
(F):5'- TCGGGACTAGTGAAGCTGC -3'
(R):5'- GAAGCAATCCAGTTTAGAAGTATCC -3'

Posted On

2018-03-15