Incidental Mutation 'R6285:Tbx6'
ID508177
Institutional Source Beutler Lab
Gene Symbol Tbx6
Ensembl Gene ENSMUSG00000030699
Gene NameT-box 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6285 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126781483-126785560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126781568 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 21 (Q21R)
Ref Sequence ENSEMBL: ENSMUSP00000126418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032936] [ENSMUST00000038614] [ENSMUST00000094037] [ENSMUST00000106356] [ENSMUST00000106357] [ENSMUST00000106359] [ENSMUST00000132643] [ENSMUST00000145762] [ENSMUST00000170882] [ENSMUST00000172352] [ENSMUST00000205786] [ENSMUST00000205935] [ENSMUST00000206570]
Predicted Effect probably benign
Transcript: ENSMUST00000032936
SMART Domains Protein: ENSMUSP00000032936
Gene: ENSMUSG00000030697

DomainStartEndE-ValueType
PP2Ac 20 290 4.04e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038614
SMART Domains Protein: ENSMUSP00000037332
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 6.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068836
Predicted Effect possibly damaging
Transcript: ENSMUST00000094037
AA Change: Q21R

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091579
Gene: ENSMUSG00000030699
AA Change: Q21R

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 332 348 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106356
SMART Domains Protein: ENSMUSP00000101963
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106357
SMART Domains Protein: ENSMUSP00000101964
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106359
Predicted Effect probably benign
Transcript: ENSMUST00000132643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143078
Predicted Effect probably benign
Transcript: ENSMUST00000145762
SMART Domains Protein: ENSMUSP00000115596
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 103 2.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156891
Predicted Effect probably benign
Transcript: ENSMUST00000170882
SMART Domains Protein: ENSMUSP00000128753
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172352
AA Change: Q21R

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126418
Gene: ENSMUSG00000030699
AA Change: Q21R

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 333 349 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205660
Predicted Effect probably benign
Transcript: ENSMUST00000205786
Predicted Effect probably benign
Transcript: ENSMUST00000205935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206143
Predicted Effect probably benign
Transcript: ENSMUST00000206477
Predicted Effect probably benign
Transcript: ENSMUST00000206570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206903
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. Knockout studies in mice indicate that this gene is important for specification of paraxial mesoderm structures. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null embryos die during organogenesis exhibiting defects in paraxial mesoderm differentiation, ectopic neural tube development, kinked neural tubes, impaired somite development, hematomas, enlarged tail buds, and laterality defects associated with nodal cilium anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,072,224 K28R probably benign Het
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cd79a A G 7: 24,899,347 N107S possibly damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dennd1a A T 2: 37,852,441 H437Q possibly damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Golga4 C T 9: 118,558,627 R616* probably null Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hipk3 T C 2: 104,471,425 M141V probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Kcp C A 6: 29,502,365 V227L probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Nrd1 G T 4: 109,038,006 V476F probably damaging Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pcdhgc5 A T 18: 37,820,621 Y316F probably benign Het
Pecam1 T C 11: 106,685,239 D490G probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Ppp2r5b T A 19: 6,230,536 Q304L probably benign Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptk6 A T 2: 181,197,093 L289Q probably null Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sept8 G T 11: 53,534,767 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in Tbx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tbx6 APN 7 126781529 missense probably damaging 1.00
IGL01899:Tbx6 APN 7 126784532 unclassified probably benign
R1018:Tbx6 UTSW 7 126783192 unclassified probably benign
R1126:Tbx6 UTSW 7 126784719 missense probably damaging 1.00
R2045:Tbx6 UTSW 7 126782883 missense probably damaging 1.00
R4913:Tbx6 UTSW 7 126784535 critical splice acceptor site probably null
R5251:Tbx6 UTSW 7 126783344 missense probably damaging 1.00
R5926:Tbx6 UTSW 7 126784853 missense possibly damaging 0.53
R5927:Tbx6 UTSW 7 126784853 missense possibly damaging 0.53
R7072:Tbx6 UTSW 7 126784740 missense probably benign 0.37
R8023:Tbx6 UTSW 7 126782859 missense possibly damaging 0.88
R8544:Tbx6 UTSW 7 126781484 splice site probably null
R9046:Tbx6 UTSW 7 126781948 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTAGGGATCAATCAGACCGAG -3'
(R):5'- CGATCCCAGAGAGGAAGCAATC -3'

Sequencing Primer
(F):5'- TCGGGACTAGTGAAGCTGC -3'
(R):5'- GAAGCAATCCAGTTTAGAAGTATCC -3'
Posted On2018-03-15