Incidental Mutation 'R6285:Golga4'
ID 508184
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
MMRRC Submission 044455-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6285 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 118387695 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 616 (R616*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
AlphaFold Q91VW5
Predicted Effect probably null
Transcript: ENSMUST00000084820
AA Change: R1606*
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: R1606*

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000211840
AA Change: R616*
Predicted Effect probably benign
Transcript: ENSMUST00000212097
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A T 3: 36,136,324 (GRCm39) M370L probably benign Het
Aimp1 A G 3: 132,373,265 (GRCm39) M225T possibly damaging Het
Atp8a1 T C 5: 67,824,950 (GRCm39) I809V possibly damaging Het
Bbs10 A G 10: 111,135,622 (GRCm39) Y245C probably damaging Het
Cabin1 A T 10: 75,520,157 (GRCm39) F1572Y probably damaging Het
Cd79a A G 7: 24,598,772 (GRCm39) N107S possibly damaging Het
Cdc7 G A 5: 107,130,925 (GRCm39) A428T probably benign Het
Cep290 A G 10: 100,359,191 (GRCm39) T974A probably benign Het
Cep350 A T 1: 155,829,120 (GRCm39) N261K possibly damaging Het
Cfap46 T A 7: 139,241,001 (GRCm39) D8V probably damaging Het
Col6a4 T C 9: 105,952,185 (GRCm39) D571G probably damaging Het
Cpe A C 8: 65,070,645 (GRCm39) V200G probably benign Het
Ctnnd1 C T 2: 84,444,231 (GRCm39) probably null Het
D5Ertd579e A C 5: 36,772,921 (GRCm39) C491W probably damaging Het
Dek A G 13: 47,252,856 (GRCm39) I183T probably damaging Het
Dennd1a A T 2: 37,742,453 (GRCm39) H437Q possibly damaging Het
Dido1 C T 2: 180,302,940 (GRCm39) A1655T probably benign Het
Eva1b A G 4: 126,043,278 (GRCm39) D106G probably damaging Het
Evc2 G T 5: 37,581,923 (GRCm39) S1189I possibly damaging Het
Faap100 A T 11: 120,267,558 (GRCm39) L405Q probably damaging Het
Fbxw15 T A 9: 109,386,234 (GRCm39) M249L probably benign Het
Gbp10 A T 5: 105,366,326 (GRCm39) L526Q probably damaging Het
Gm19402 A C 10: 77,526,354 (GRCm39) probably benign Het
Gm2244 A G 14: 19,590,865 (GRCm39) Y141H probably damaging Het
Gm4181 A T 14: 51,870,666 (GRCm39) N98K probably damaging Het
Gpank1 T A 17: 35,343,266 (GRCm39) S226T probably damaging Het
Hipk3 T C 2: 104,301,770 (GRCm39) M141V probably damaging Het
Hoxc11 T C 15: 102,863,178 (GRCm39) V73A probably benign Het
Igf1r T G 7: 67,653,885 (GRCm39) I141S possibly damaging Het
Jak2 T A 19: 29,273,059 (GRCm39) F628I probably benign Het
Kcp C A 6: 29,502,364 (GRCm39) V227L probably benign Het
Knl1 T G 2: 118,902,422 (GRCm39) C1374W probably damaging Het
Larp6 A T 9: 60,645,043 (GRCm39) R394S probably benign Het
Lilra5 G A 7: 4,245,114 (GRCm39) G253R probably damaging Het
Map3k4 A G 17: 12,482,945 (GRCm39) S591P probably damaging Het
Mdfic2 T C 6: 98,215,134 (GRCm39) D163G probably damaging Het
Minar2 A G 18: 59,205,296 (GRCm39) K28R probably benign Het
Mrpl16 T A 19: 11,750,332 (GRCm39) I72K probably damaging Het
Nol11 C G 11: 107,071,860 (GRCm39) R244S probably benign Het
Nr2f1 T C 13: 78,343,782 (GRCm39) T161A probably benign Het
Nrdc G T 4: 108,895,203 (GRCm39) V476F probably damaging Het
Or10j7 G T 1: 173,011,477 (GRCm39) H175N probably damaging Het
Or10z1 A T 1: 174,078,395 (GRCm39) S33T possibly damaging Het
Or13a22 T A 7: 140,072,626 (GRCm39) L25Q possibly damaging Het
Or13m2-ps1 A T 6: 42,777,843 (GRCm39) H56L probably benign Het
P2rx1 A G 11: 72,898,974 (GRCm39) I62V probably benign Het
Pcdhgc5 A T 18: 37,953,674 (GRCm39) Y316F probably benign Het
Pecam1 T C 11: 106,576,065 (GRCm39) D490G probably benign Het
Pfkfb2 A T 1: 130,635,299 (GRCm39) Y87* probably null Het
Poldip2 A G 11: 78,408,458 (GRCm39) probably null Het
Ppp2r5b T A 19: 6,280,566 (GRCm39) Q304L probably benign Het
Pramel26 A G 4: 143,542,609 (GRCm39) C4R probably damaging Het
Psg26 A G 7: 18,216,753 (GRCm39) F29L probably benign Het
Ptk6 A T 2: 180,838,886 (GRCm39) L289Q probably null Het
Ptprt A T 2: 161,743,417 (GRCm39) I508N possibly damaging Het
Rasgrp4 T C 7: 28,847,808 (GRCm39) F406S probably damaging Het
Rspo3 A G 10: 29,375,926 (GRCm39) probably null Het
Septin8 G T 11: 53,425,594 (GRCm39) probably null Het
Sirt2 A C 7: 28,487,471 (GRCm39) T345P probably benign Het
Slc6a20b T C 9: 123,438,161 (GRCm39) E205G possibly damaging Het
Sqstm1 G A 11: 50,093,418 (GRCm39) Q327* probably null Het
Susd3 T A 13: 49,390,997 (GRCm39) S98C probably damaging Het
Tada2b G A 5: 36,634,186 (GRCm39) R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 (GRCm39) V546E possibly damaging Het
Tbx6 A G 7: 126,380,740 (GRCm39) Q21R possibly damaging Het
Usp24 T G 4: 106,231,297 (GRCm39) probably null Het
Vinac1 T G 2: 128,879,719 (GRCm39) T736P possibly damaging Het
Vmn2r103 A G 17: 20,032,406 (GRCm39) T727A probably benign Het
Wdr48 C T 9: 119,749,676 (GRCm39) T531M probably damaging Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118,382,521 (GRCm39) missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118,389,808 (GRCm39) critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R1818:Golga4 UTSW 9 118,402,055 (GRCm39) missense probably damaging 1.00
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4519:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4546:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4580:Golga4 UTSW 9 118,386,327 (GRCm39) missense probably benign 0.00
R4918:Golga4 UTSW 9 118,387,213 (GRCm39) missense probably damaging 1.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5567:Golga4 UTSW 9 118,387,251 (GRCm39) missense probably damaging 1.00
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7212:Golga4 UTSW 9 118,365,908 (GRCm39) missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118,388,563 (GRCm39) missense probably benign
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7729:Golga4 UTSW 9 118,385,131 (GRCm39) missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R8856:Golga4 UTSW 9 118,385,779 (GRCm39) missense probably damaging 0.98
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACAGCAAGGGTCGTTGAATTAG -3'
(R):5'- GAGACAAGAGCTGCTTCCTG -3'

Sequencing Primer
(F):5'- TTAGAAGACTGCGTTACTCAGAG -3'
(R):5'- AAGAGCTGCTTCCTGATGGCAG -3'
Posted On 2018-03-15