Incidental Mutation 'R6285:Golga4'
ID508184
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Namegolgi autoantigen, golgin subfamily a, 4
Synonymsgolgin-245, Olp-1
MMRRC Submission
Accession Numbers

Genbank: NM_018748; MGI: 1859646  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6285 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location118506267-118582519 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 118558627 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 616 (R616*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
Predicted Effect probably null
Transcript: ENSMUST00000084820
AA Change: R1606*
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: R1606*

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000211840
AA Change: R616*
Predicted Effect probably benign
Transcript: ENSMUST00000212097
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,072,224 K28R probably benign Het
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cd79a A G 7: 24,899,347 N107S possibly damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dennd1a A T 2: 37,852,441 H437Q possibly damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hipk3 T C 2: 104,471,425 M141V probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Kcp C A 6: 29,502,365 V227L probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Nrd1 G T 4: 109,038,006 V476F probably damaging Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pcdhgc5 A T 18: 37,820,621 Y316F probably benign Het
Pecam1 T C 11: 106,685,239 D490G probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Ppp2r5b T A 19: 6,230,536 Q304L probably benign Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptk6 A T 2: 181,197,093 L289Q probably null Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sept8 G T 11: 53,534,767 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Tbx6 A G 7: 126,781,568 Q21R possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118514271 critical splice donor site probably null
IGL00801:Golga4 APN 9 118538926 missense probably damaging 0.98
IGL01395:Golga4 APN 9 118535373 missense probably damaging 1.00
IGL01472:Golga4 APN 9 118532574 missense probably damaging 1.00
IGL01519:Golga4 APN 9 118527092 missense probably damaging 1.00
IGL01563:Golga4 APN 9 118527006 splice site probably benign
IGL02593:Golga4 APN 9 118555566 unclassified probably benign
IGL02803:Golga4 APN 9 118535460 missense probably benign
IGL02939:Golga4 APN 9 118535454 missense probably benign 0.01
IGL02939:Golga4 APN 9 118534632 missense probably damaging 1.00
IGL03123:Golga4 APN 9 118536885 missense probably damaging 1.00
IGL03334:Golga4 APN 9 118537233 splice site probably benign
F5770:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118553457 missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118553453 missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118560740 critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118568993 missense probably benign 0.00
R0362:Golga4 UTSW 9 118555785 missense probably benign 0.13
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0974:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R1128:Golga4 UTSW 9 118548784 missense probably benign 0.40
R1384:Golga4 UTSW 9 118565651 missense probably damaging 0.99
R1435:Golga4 UTSW 9 118535440 missense probably benign 0.00
R1513:Golga4 UTSW 9 118555732 missense probably benign 0.02
R1818:Golga4 UTSW 9 118572987 missense probably damaging 1.00
R2083:Golga4 UTSW 9 118532590 missense probably damaging 1.00
R2243:Golga4 UTSW 9 118556904 missense probably benign 0.06
R2355:Golga4 UTSW 9 118560742 missense probably benign 0.00
R2518:Golga4 UTSW 9 118556612 missense probably damaging 1.00
R2921:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118557380 missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118534647 missense probably benign 0.16
R3909:Golga4 UTSW 9 118558736 missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118538971 missense probably damaging 0.99
R4321:Golga4 UTSW 9 118556435 missense probably damaging 1.00
R4358:Golga4 UTSW 9 118551878 missense probably benign 0.16
R4483:Golga4 UTSW 9 118514186 missense probably damaging 1.00
R4515:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4518:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4519:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4545:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4546:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4580:Golga4 UTSW 9 118557259 missense probably benign 0.00
R4918:Golga4 UTSW 9 118558145 missense probably damaging 1.00
R5007:Golga4 UTSW 9 118558300 missense probably benign
R5045:Golga4 UTSW 9 118565656 missense probably benign
R5232:Golga4 UTSW 9 118506558 critical splice donor site probably null
R5256:Golga4 UTSW 9 118556501 missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118559057 nonsense probably null
R5567:Golga4 UTSW 9 118558183 missense probably damaging 1.00
R5576:Golga4 UTSW 9 118553534 missense probably benign 0.13
R5771:Golga4 UTSW 9 118558283 missense probably damaging 0.96
R5807:Golga4 UTSW 9 118527130 missense probably damaging 0.99
R5860:Golga4 UTSW 9 118558106 missense probably damaging 1.00
R6012:Golga4 UTSW 9 118559696 missense possibly damaging 0.90
R6299:Golga4 UTSW 9 118557370 missense probably benign 0.03
R6467:Golga4 UTSW 9 118536792 missense probably damaging 1.00
R6552:Golga4 UTSW 9 118514231 missense probably damaging 1.00
R6688:Golga4 UTSW 9 118514210 missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118548779 missense probably damaging 1.00
R6987:Golga4 UTSW 9 118558532 missense probably benign
R7212:Golga4 UTSW 9 118536840 missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118559495 missense probably benign
R7431:Golga4 UTSW 9 118559731 missense probably damaging 1.00
R7641:Golga4 UTSW 9 118557575 missense probably benign 0.05
R7727:Golga4 UTSW 9 118548702 missense probably damaging 1.00
R7729:Golga4 UTSW 9 118556063 missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118532575 missense probably damaging 1.00
R7849:Golga4 UTSW 9 118559311 missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118556366 missense probably damaging 1.00
R7932:Golga4 UTSW 9 118559311 missense possibly damaging 0.93
R7974:Golga4 UTSW 9 118556366 missense probably damaging 1.00
RF022:Golga4 UTSW 9 118557989 missense probably damaging 1.00
V7583:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACAGCAAGGGTCGTTGAATTAG -3'
(R):5'- GAGACAAGAGCTGCTTCCTG -3'

Sequencing Primer
(F):5'- TTAGAAGACTGCGTTACTCAGAG -3'
(R):5'- AAGAGCTGCTTCCTGATGGCAG -3'
Posted On2018-03-15