Incidental Mutation 'R6285:Sept8'
ID508193
Institutional Source Beutler Lab
Gene Symbol Sept8
Ensembl Gene ENSMUSG00000018398
Gene Nameseptin 8
SynonymsSepl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R6285 (G1)
Quality Score217.009
Status Validated
Chromosome11
Chromosomal Location53519257-53549565 bp(+) (GRCm38)
Type of Mutationintron (139 bp from exon)
DNA Base Change (assembly) G to T at 53534767 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108987] [ENSMUST00000117061] [ENSMUST00000120878] [ENSMUST00000121334] [ENSMUST00000142800] [ENSMUST00000147912]
Predicted Effect probably null
Transcript: ENSMUST00000108987
SMART Domains Protein: ENSMUSP00000104615
Gene: ENSMUSG00000018398

DomainStartEndE-ValueType
Pfam:Septin 41 314 1.9e-101 PFAM
Pfam:MMR_HSR1 46 191 5.7e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117061
SMART Domains Protein: ENSMUSP00000112920
Gene: ENSMUSG00000018398

DomainStartEndE-ValueType
Pfam:Septin 41 314 6.5e-101 PFAM
Pfam:MMR_HSR1 46 191 1.3e-6 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120878
SMART Domains Protein: ENSMUSP00000113775
Gene: ENSMUSG00000018398

DomainStartEndE-ValueType
Pfam:Septin 41 312 6.4e-98 PFAM
Pfam:MMR_HSR1 46 190 6.3e-7 PFAM
low complexity region 349 372 N/A INTRINSIC
low complexity region 377 392 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121334
SMART Domains Protein: ENSMUSP00000113038
Gene: ENSMUSG00000018398

DomainStartEndE-ValueType
Pfam:Septin 41 314 1.9e-100 PFAM
Pfam:MMR_HSR1 46 187 2.6e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000142800
SMART Domains Protein: ENSMUSP00000124057
Gene: ENSMUSG00000018398

DomainStartEndE-ValueType
Pfam:Septin 1 51 5.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145927
Predicted Effect probably null
Transcript: ENSMUST00000147912
SMART Domains Protein: ENSMUSP00000120427
Gene: ENSMUSG00000018398

DomainStartEndE-ValueType
Pfam:Septin 41 314 2.1e-101 PFAM
Pfam:MMR_HSR1 46 190 6e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit myelin outfoldings and reduced nerve conduction velocity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,072,224 K28R probably benign Het
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cd79a A G 7: 24,899,347 N107S possibly damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dennd1a A T 2: 37,852,441 H437Q possibly damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Golga4 C T 9: 118,558,627 R616* probably null Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hipk3 T C 2: 104,471,425 M141V probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Kcp C A 6: 29,502,365 V227L probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Nrd1 G T 4: 109,038,006 V476F probably damaging Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pcdhgc5 A T 18: 37,820,621 Y316F probably benign Het
Pecam1 T C 11: 106,685,239 D490G probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Ppp2r5b T A 19: 6,230,536 Q304L probably benign Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptk6 A T 2: 181,197,093 L289Q probably null Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Tbx6 A G 7: 126,781,568 Q21R possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in Sept8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Sept8 APN 11 53531996 missense probably benign 0.08
IGL01649:Sept8 APN 11 53535028 missense possibly damaging 0.79
IGL02131:Sept8 APN 11 53537857 missense possibly damaging 0.79
IGL02547:Sept8 APN 11 53537265 missense probably damaging 1.00
R0856:Sept8 UTSW 11 53537870 missense probably benign 0.01
R0908:Sept8 UTSW 11 53537870 missense probably benign 0.01
R1799:Sept8 UTSW 11 53534483 missense probably benign 0.32
R3774:Sept8 UTSW 11 53537579 missense probably damaging 1.00
R4747:Sept8 UTSW 11 53536718 missense probably damaging 1.00
R4810:Sept8 UTSW 11 53534589 missense probably damaging 0.97
R5034:Sept8 UTSW 11 53534438 missense probably damaging 1.00
R5313:Sept8 UTSW 11 53535982 missense probably damaging 1.00
R5652:Sept8 UTSW 11 53537217 missense probably damaging 1.00
R6263:Sept8 UTSW 11 53548383 missense probably benign 0.00
R6289:Sept8 UTSW 11 53534478 missense probably damaging 0.99
R6571:Sept8 UTSW 11 53537163 missense probably damaging 1.00
R7238:Sept8 UTSW 11 53536692 missense possibly damaging 0.68
R7249:Sept8 UTSW 11 53535122 missense probably damaging 0.97
R7646:Sept8 UTSW 11 53537917 critical splice donor site probably null
R7691:Sept8 UTSW 11 53537587 missense probably benign 0.00
R8170:Sept8 UTSW 11 53537857 missense possibly damaging 0.79
X0024:Sept8 UTSW 11 53536724 nonsense probably null
X0058:Sept8 UTSW 11 53535085 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAGCTGACCATCGTGGATGC -3'
(R):5'- GATGTAGTCAACTATGGGCCTG -3'

Sequencing Primer
(F):5'- ACCATCGTGGATGCTGTGG -3'
(R):5'- GTCAACTATGGGCCTGTAACTAC -3'
Posted On2018-03-15