Incidental Mutation 'R6285:Pecam1'
ID508196
Institutional Source Beutler Lab
Gene Symbol Pecam1
Ensembl Gene ENSMUSG00000020717
Gene Nameplatelet/endothelial cell adhesion molecule 1
SynonymsCd31, PECAM-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6285 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106654217-106750628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106685239 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 490 (D490G)
Ref Sequence ENSEMBL: ENSMUSP00000067111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068021] [ENSMUST00000080853] [ENSMUST00000103069] [ENSMUST00000106796] [ENSMUST00000183610]
Predicted Effect probably benign
Transcript: ENSMUST00000068021
AA Change: D490G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000067111
Gene: ENSMUSG00000020717
AA Change: D490G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
Pfam:Ig_3 122 198 4.2e-4 PFAM
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 718 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000080853
AA Change: D490G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000079664
Gene: ENSMUSG00000020717
AA Change: D490G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 710 4e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000103069
AA Change: D490G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099358
Gene: ENSMUSG00000020717
AA Change: D490G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106796
AA Change: D490G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102408
Gene: ENSMUSG00000020717
AA Change: D490G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 727 1e-16 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135481
Predicted Effect probably benign
Transcript: ENSMUST00000183610
AA Change: D389G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138959
Gene: ENSMUSG00000020717
AA Change: D389G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 129 210 1.38e2 SMART
IG_like 226 281 2e-1 SMART
Blast:IG_like 304 385 2e-31 BLAST
IG 396 483 5.49e-1 SMART
transmembrane domain 491 513 N/A INTRINSIC
PDB:2KY5|A 575 626 1e-16 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found on the surface of platelets, monocytes, neutrophils, and some types of T-cells, and makes up a large portion of endothelial cell intercellular junctions. The encoded protein is a member of the immunoglobulin superfamily and is likely involved in leukocyte migration, angiogenesis, and integrin activation. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show increased susceptibility to collagen-induced arthritis, impaired lung alveolarization, and enhanced susceptibility to endotoxic shock. Mice homozygous for a gene-trapped allele show altered vasodilation and nitric oxide homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,072,224 K28R probably benign Het
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cd79a A G 7: 24,899,347 N107S possibly damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dennd1a A T 2: 37,852,441 H437Q possibly damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Golga4 C T 9: 118,558,627 R616* probably null Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hipk3 T C 2: 104,471,425 M141V probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Kcp C A 6: 29,502,365 V227L probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Nrd1 G T 4: 109,038,006 V476F probably damaging Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pcdhgc5 A T 18: 37,820,621 Y316F probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Ppp2r5b T A 19: 6,230,536 Q304L probably benign Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptk6 A T 2: 181,197,093 L289Q probably null Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sept8 G T 11: 53,534,767 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Tbx6 A G 7: 126,781,568 Q21R possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in Pecam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Pecam1 APN 11 106699798 missense probably damaging 1.00
IGL01914:Pecam1 APN 11 106699867 missense possibly damaging 0.95
IGL02035:Pecam1 APN 11 106695859 missense probably benign 0.43
IGL02124:Pecam1 APN 11 106690981 missense probably damaging 0.98
IGL02487:Pecam1 APN 11 106671780 missense probably damaging 1.00
IGL02576:Pecam1 APN 11 106671774 missense probably damaging 1.00
IGL03101:Pecam1 APN 11 106697351 missense probably damaging 0.99
R1495:Pecam1 UTSW 11 106688856 missense probably damaging 0.96
R1614:Pecam1 UTSW 11 106681079 missense probably benign 0.00
R1628:Pecam1 UTSW 11 106682960 splice site probably null
R1950:Pecam1 UTSW 11 106685203 missense probably damaging 1.00
R1994:Pecam1 UTSW 11 106695937 missense possibly damaging 0.95
R3149:Pecam1 UTSW 11 106684281 missense possibly damaging 0.53
R4022:Pecam1 UTSW 11 106655160 missense probably benign 0.00
R4418:Pecam1 UTSW 11 106695922 missense possibly damaging 0.61
R4747:Pecam1 UTSW 11 106684246 missense probably benign 0.29
R4828:Pecam1 UTSW 11 106699808 missense probably damaging 1.00
R5798:Pecam1 UTSW 11 106695832 missense possibly damaging 0.95
R5864:Pecam1 UTSW 11 106684250 nonsense probably null
R5942:Pecam1 UTSW 11 106661983 intron probably benign
R5966:Pecam1 UTSW 11 106691061 missense probably benign 0.44
R6519:Pecam1 UTSW 11 106699642 missense probably benign 0.01
R7078:Pecam1 UTSW 11 106688947 missense probably benign 0.06
R7135:Pecam1 UTSW 11 106689031 missense probably damaging 0.99
R7215:Pecam1 UTSW 11 106695919 missense probably benign 0.15
R7574:Pecam1 UTSW 11 106699784 missense probably damaging 1.00
R7795:Pecam1 UTSW 11 106695832 nonsense probably null
R7855:Pecam1 UTSW 11 106671750 missense probably benign 0.00
R8296:Pecam1 UTSW 11 106688919 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTTGTTGTGCCAAAACGC -3'
(R):5'- AAGAAGCAGTGGCCATTCTG -3'

Sequencing Primer
(F):5'- CAAAACGCTTGGGTGTCATTCAC -3'
(R):5'- AAGCAGTGGCCATTCTGTGTTC -3'
Posted On2018-03-15