Incidental Mutation 'R6285:A730017C20Rik'
ID508209
Institutional Source Beutler Lab
Gene Symbol A730017C20Rik
Ensembl Gene ENSMUSG00000050875
Gene NameRIKEN cDNA A730017C20 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6285 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location59062248-59076962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59072224 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 28 (K28R)
Ref Sequence ENSEMBL: ENSMUSP00000135330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058633] [ENSMUST00000117064] [ENSMUST00000118510] [ENSMUST00000165666] [ENSMUST00000175830]
Predicted Effect probably benign
Transcript: ENSMUST00000058633
AA Change: K28R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000056379
Gene: ENSMUSG00000050875
AA Change: K28R

DomainStartEndE-ValueType
Pfam:UPF0258 4 151 7.2e-29 PFAM
Predicted Effect silent
Transcript: ENSMUST00000117064
Predicted Effect probably benign
Transcript: ENSMUST00000118510
AA Change: K28R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113023
Gene: ENSMUSG00000050875
AA Change: K28R

DomainStartEndE-ValueType
Pfam:UPF0258 4 151 7.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154125
Predicted Effect probably benign
Transcript: ENSMUST00000165666
AA Change: K70R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125952
Gene: ENSMUSG00000050875
AA Change: K70R

DomainStartEndE-ValueType
Pfam:UPF0258 51 192 3.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175830
AA Change: K28R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135330
Gene: ENSMUSG00000050875
AA Change: K28R

DomainStartEndE-ValueType
Pfam:UPF0258 4 150 6.2e-41 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000175897
AA Change: K60R
SMART Domains Protein: ENSMUSP00000135020
Gene: ENSMUSG00000050875
AA Change: K60R

DomainStartEndE-ValueType
Pfam:UPF0258 25 146 4e-30 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cd79a A G 7: 24,899,347 N107S possibly damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dennd1a A T 2: 37,852,441 H437Q possibly damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Golga4 C T 9: 118,558,627 R616* probably null Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hipk3 T C 2: 104,471,425 M141V probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Kcp C A 6: 29,502,365 V227L probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Nrd1 G T 4: 109,038,006 V476F probably damaging Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pcdhgc5 A T 18: 37,820,621 Y316F probably benign Het
Pecam1 T C 11: 106,685,239 D490G probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Ppp2r5b T A 19: 6,230,536 Q304L probably benign Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptk6 A T 2: 181,197,093 L289Q probably null Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sept8 G T 11: 53,534,767 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Tbx6 A G 7: 126,781,568 Q21R possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in A730017C20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:A730017C20Rik APN 18 59072277 missense probably damaging 0.98
IGL01363:A730017C20Rik APN 18 59072308 missense probably damaging 0.99
IGL01621:A730017C20Rik APN 18 59062386 start codon destroyed probably null 0.27
IGL02546:A730017C20Rik APN 18 59072275 missense probably damaging 0.98
R0200:A730017C20Rik UTSW 18 59062459 splice site probably null
R0390:A730017C20Rik UTSW 18 59075688 missense probably damaging 0.98
R0470:A730017C20Rik UTSW 18 59075639 missense probably damaging 1.00
R0608:A730017C20Rik UTSW 18 59062459 splice site probably null
R1980:A730017C20Rik UTSW 18 59075667 missense probably damaging 0.96
R4916:A730017C20Rik UTSW 18 59072205 missense probably damaging 0.98
R7252:A730017C20Rik UTSW 18 59066908 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGATCAAGGGGTTGTTTTCTAAC -3'
(R):5'- TACCTCATCCGTTGGAGACC -3'

Sequencing Primer
(F):5'- AAGGGGTTGTTTTCTAACTTCATTGC -3'
(R):5'- CACCTTCAGATGTCCAGAGAGATTTG -3'
Posted On2018-03-15