Incidental Mutation 'R6285:Ppp2r5b'
ID508210
Institutional Source Beutler Lab
Gene Symbol Ppp2r5b
Ensembl Gene ENSMUSG00000024777
Gene Nameprotein phosphatase 2, regulatory subunit B', beta
SynonymsB'beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R6285 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6227765-6235872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6230536 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 304 (Q304L)
Ref Sequence ENSEMBL: ENSMUSP00000025695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025695] [ENSMUST00000025698] [ENSMUST00000113526]
Predicted Effect probably benign
Transcript: ENSMUST00000025695
AA Change: Q304L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025695
Gene: ENSMUSG00000024777
AA Change: Q304L

DomainStartEndE-ValueType
low complexity region 6 25 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
Pfam:B56 62 467 5.2e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025698
SMART Domains Protein: ENSMUSP00000025698
Gene: ENSMUSG00000024784

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:DAN 17 126 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113526
SMART Domains Protein: ENSMUSP00000109154
Gene: ENSMUSG00000024784

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:DAN 16 123 1.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153155
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B56 subfamily. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,072,224 K28R probably benign Het
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cd79a A G 7: 24,899,347 N107S possibly damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dennd1a A T 2: 37,852,441 H437Q possibly damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Golga4 C T 9: 118,558,627 R616* probably null Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hipk3 T C 2: 104,471,425 M141V probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Kcp C A 6: 29,502,365 V227L probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Nrd1 G T 4: 109,038,006 V476F probably damaging Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pcdhgc5 A T 18: 37,820,621 Y316F probably benign Het
Pecam1 T C 11: 106,685,239 D490G probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptk6 A T 2: 181,197,093 L289Q probably null Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sept8 G T 11: 53,534,767 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Tbx6 A G 7: 126,781,568 Q21R possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in Ppp2r5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Ppp2r5b APN 19 6230968 missense probably damaging 1.00
IGL02714:Ppp2r5b APN 19 6234707 missense probably damaging 0.99
IGL02937:Ppp2r5b APN 19 6230986 missense probably damaging 1.00
PIT4696001:Ppp2r5b UTSW 19 6234683 missense probably benign 0.12
R0114:Ppp2r5b UTSW 19 6228431 missense probably benign
R0333:Ppp2r5b UTSW 19 6229047 unclassified probably benign
R0627:Ppp2r5b UTSW 19 6232634 unclassified probably benign
R1477:Ppp2r5b UTSW 19 6230227 missense probably benign 0.01
R1628:Ppp2r5b UTSW 19 6230905 critical splice donor site probably null
R4066:Ppp2r5b UTSW 19 6229330 missense probably damaging 1.00
R4834:Ppp2r5b UTSW 19 6230510 missense possibly damaging 0.81
R5854:Ppp2r5b UTSW 19 6230944 missense probably damaging 1.00
R5895:Ppp2r5b UTSW 19 6234734 missense probably damaging 1.00
R6102:Ppp2r5b UTSW 19 6234738 missense probably benign 0.00
R7087:Ppp2r5b UTSW 19 6232550 missense possibly damaging 0.46
R7391:Ppp2r5b UTSW 19 6228514 missense probably benign 0.00
R7576:Ppp2r5b UTSW 19 6228484 missense possibly damaging 0.76
R7799:Ppp2r5b UTSW 19 6232598 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TGAGAGCCCTTCATACCTCC -3'
(R):5'- TACCTGAGAGCTGACCTCAC -3'

Sequencing Primer
(F):5'- ATACCTCCTTCTGGGTGCAGG -3'
(R):5'- ACTCAGAGCGGGGTTCCTTG -3'
Posted On2018-03-15