Incidental Mutation 'R6286:Ptpn4'
ID508215
Institutional Source Beutler Lab
Gene Symbol Ptpn4
Ensembl Gene ENSMUSG00000026384
Gene Nameprotein tyrosine phosphatase, non-receptor type 4
SynonymsTEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R6286 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location119652467-119837613 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 119721862 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000163179] [ENSMUST00000163435]
Predicted Effect probably null
Transcript: ENSMUST00000064091
SMART Domains Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDZ 526 605 2.47e-14 SMART
PTPc 654 913 1.38e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163179
Predicted Effect probably null
Transcript: ENSMUST00000163435
SMART Domains Protein: ENSMUSP00000127713
Gene: ENSMUSG00000026384

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDB:3NFL|D 499 552 4e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164269
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T A 17: 71,880,847 M1300L probably damaging Het
BC080695 T A 4: 143,571,226 V72D probably benign Het
C3 A T 17: 57,224,118 I356N probably damaging Het
Cntnap5b T A 1: 100,255,073 S276T possibly damaging Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp11a1 G A 9: 58,017,418 probably benign Het
Ddx4 T C 13: 112,613,735 T421A probably damaging Het
Dnttip2 A G 3: 122,284,400 T694A probably damaging Het
Eif3b G T 5: 140,419,811 D151Y probably damaging Het
Fhad1 T A 4: 141,920,898 E219V probably damaging Het
Gdf2 C T 14: 33,945,100 R260C probably damaging Het
Gm14295 T C 2: 176,809,568 Y284H possibly damaging Het
Gm45861 A G 8: 27,529,591 T745A unknown Het
Grin2a G A 16: 9,761,775 T208I possibly damaging Het
Ide T A 19: 37,278,010 Y798F unknown Het
Llgl1 G A 11: 60,709,532 G569D probably damaging Het
Mrpl9 G C 3: 94,443,790 E92D probably benign Het
Muc16 T A 9: 18,644,389 H3536L unknown Het
Nasp T C 4: 116,604,788 Y526C probably damaging Het
Nfx1 A G 4: 40,986,728 N404D probably damaging Het
Nsrp1 A G 11: 77,049,443 I112T probably damaging Het
Olfr145 A T 9: 37,897,778 I125F probably damaging Het
Olfr789 T C 10: 129,487,628 L206P probably damaging Het
Oxsr1 A G 9: 119,264,882 V235A probably damaging Het
Pamr1 C T 2: 102,640,948 Q539* probably null Het
Ranbp2 C T 10: 58,479,572 A2038V probably benign Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Sept5 A G 16: 18,623,377 V253A probably damaging Het
Slc22a13 C A 9: 119,208,712 E117* probably null Het
Slc9c1 T C 16: 45,577,831 I653T probably benign Het
Slco6c1 T A 1: 97,125,720 H152L possibly damaging Het
Sp2 A C 11: 96,961,546 V184G probably benign Het
Taok1 T A 11: 77,553,773 H492L probably benign Het
Tas2r110 G A 6: 132,868,527 D174N probably benign Het
Trim24 G A 6: 37,919,491 probably null Het
Ttc37 T C 13: 76,143,240 L993P probably damaging Het
Ttn G A 2: 76,750,977 R21445* probably null Het
Ttn A G 2: 76,775,623 Y16502H probably damaging Het
Vmn2r84 A C 10: 130,390,868 M367R possibly damaging Het
Zfp46 T C 4: 136,291,009 S385P probably damaging Het
Other mutations in Ptpn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ptpn4 APN 1 119659925 splice site probably benign
IGL00885:Ptpn4 APN 1 119802363 missense possibly damaging 0.95
IGL00973:Ptpn4 APN 1 119741371 missense probably benign 0.00
IGL01867:Ptpn4 APN 1 119675599 missense probably benign
IGL01870:Ptpn4 APN 1 119675547 critical splice donor site probably null
IGL02101:Ptpn4 APN 1 119687678 missense probably damaging 1.00
IGL02344:Ptpn4 APN 1 119773260 missense probably damaging 1.00
IGL02348:Ptpn4 APN 1 119682722 missense probably damaging 1.00
IGL02693:Ptpn4 APN 1 119715969 missense probably damaging 0.96
IGL03281:Ptpn4 APN 1 119659912 missense probably damaging 1.00
botched UTSW 1 119743390 missense probably damaging 1.00
bungled UTSW 1 119687605 splice site probably null
hash UTSW 1 119765919 nonsense probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0504:Ptpn4 UTSW 1 119765915 missense probably damaging 1.00
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1148:Ptpn4 UTSW 1 119675709 splice site probably benign
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1662:Ptpn4 UTSW 1 119765058 missense probably damaging 0.96
R1694:Ptpn4 UTSW 1 119783510 missense probably damaging 0.99
R1733:Ptpn4 UTSW 1 119716043 intron probably null
R2083:Ptpn4 UTSW 1 119687759 missense possibly damaging 0.63
R2226:Ptpn4 UTSW 1 119682785 missense probably damaging 1.00
R2276:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R2277:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R3123:Ptpn4 UTSW 1 119765423 splice site probably null
R3425:Ptpn4 UTSW 1 119707830 missense probably benign 0.02
R4568:Ptpn4 UTSW 1 119680059 missense probably damaging 1.00
R4716:Ptpn4 UTSW 1 119721868 missense probably damaging 1.00
R4819:Ptpn4 UTSW 1 119659850 missense probably benign
R4959:Ptpn4 UTSW 1 119765096 nonsense probably null
R5161:Ptpn4 UTSW 1 119707863 nonsense probably null
R5345:Ptpn4 UTSW 1 119765477 missense probably benign
R5471:Ptpn4 UTSW 1 119765919 nonsense probably null
R5826:Ptpn4 UTSW 1 119684516 missense probably benign 0.32
R5933:Ptpn4 UTSW 1 119687723 missense probably damaging 0.97
R6075:Ptpn4 UTSW 1 119765136 missense probably damaging 1.00
R6389:Ptpn4 UTSW 1 119721954 missense probably damaging 0.97
R6392:Ptpn4 UTSW 1 119773123 missense probably benign
R6769:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6771:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6794:Ptpn4 UTSW 1 119743390 missense probably damaging 1.00
R6933:Ptpn4 UTSW 1 119773148 intron probably benign
R6967:Ptpn4 UTSW 1 119684581 nonsense probably null
R6980:Ptpn4 UTSW 1 119743421 missense possibly damaging 0.86
R7150:Ptpn4 UTSW 1 119691745 critical splice donor site probably null
R7247:Ptpn4 UTSW 1 119690034 makesense probably null
R7283:Ptpn4 UTSW 1 119682531 missense possibly damaging 0.90
R7459:Ptpn4 UTSW 1 119659834 missense probably damaging 0.99
R7732:Ptpn4 UTSW 1 119692802 missense probably benign
R7794:Ptpn4 UTSW 1 119726037 missense probably damaging 1.00
R8061:Ptpn4 UTSW 1 119691600 critical splice donor site probably null
RF014:Ptpn4 UTSW 1 119684465 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTCAGTAGGTTTTGCAACTAACC -3'
(R):5'- GCATGAATCTAGAGAAACATTACTGGG -3'

Sequencing Primer
(F):5'- GTTACACACAGCTGTAAGATGCCATG -3'
(R):5'- GATAGACCACTTCCACCT -3'
Posted On2018-03-15