Mutagenetix > Incidental Mutations

Incidental Mutation 'R6286:Muc16'

508233

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.197) question?

Stock #

R6286 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 18644389 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 3536 (H3536L)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

unknown
Transcript: ENSMUST00000208663
AA Change: H3536L

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

98% (40/41)

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alk	T	A	17: 71,880,847	M1300L	probably damaging	Het
BC080695	T	A	4: 143,571,226	V72D	probably benign	Het
C3	A	T	17: 57,224,118	I356N	probably damaging	Het
Cntnap5b	T	A	1: 100,255,073	S276T	possibly damaging	Het
Cts7	C	T	13: 61,352,770	G321E	probably damaging	Het
Cyp11a1	G	A	9: 58,017,418		probably benign	Het
Ddx4	T	C	13: 112,613,735	T421A	probably damaging	Het
Dnttip2	A	G	3: 122,284,400	T694A	probably damaging	Het
Eif3b	G	T	5: 140,419,811	D151Y	probably damaging	Het
Fhad1	T	A	4: 141,920,898	E219V	probably damaging	Het
Gdf2	C	T	14: 33,945,100	R260C	probably damaging	Het
Gm14295	T	C	2: 176,809,568	Y284H	possibly damaging	Het
Gm45861	A	G	8: 27,529,591	T745A	unknown	Het
Grin2a	G	A	16: 9,761,775	T208I	possibly damaging	Het
Ide	T	A	19: 37,278,010	Y798F	unknown	Het
Llgl1	G	A	11: 60,709,532	G569D	probably damaging	Het
Mrpl9	G	C	3: 94,443,790	E92D	probably benign	Het
Nasp	T	C	4: 116,604,788	Y526C	probably damaging	Het
Nfx1	A	G	4: 40,986,728	N404D	probably damaging	Het
Nsrp1	A	G	11: 77,049,443	I112T	probably damaging	Het
Olfr145	A	T	9: 37,897,778	I125F	probably damaging	Het
Olfr789	T	C	10: 129,487,628	L206P	probably damaging	Het
Oxsr1	A	G	9: 119,264,882	V235A	probably damaging	Het
Pamr1	C	T	2: 102,640,948	Q539*	probably null	Het
Ptpn4	A	G	1: 119,721,862		probably null	Het
Ranbp2	C	T	10: 58,479,572	A2038V	probably benign	Het
Rsf1	G	GACGGCGGCA	7: 97,579,909		probably benign	Homo
Sept5	A	G	16: 18,623,377	V253A	probably damaging	Het
Slc22a13	C	A	9: 119,208,712	E117*	probably null	Het
Slc9c1	T	C	16: 45,577,831	I653T	probably benign	Het
Slco6c1	T	A	1: 97,125,720	H152L	possibly damaging	Het
Sp2	A	C	11: 96,961,546	V184G	probably benign	Het
Taok1	T	A	11: 77,553,773	H492L	probably benign	Het
Tas2r110	G	A	6: 132,868,527	D174N	probably benign	Het
Trim24	G	A	6: 37,919,491		probably null	Het
Ttc37	T	C	13: 76,143,240	L993P	probably damaging	Het
Ttn	G	A	2: 76,750,977	R21445*	probably null	Het
Ttn	A	G	2: 76,775,623	Y16502H	probably damaging	Het
Vmn2r84	A	C	10: 130,390,868	M367R	possibly damaging	Het
Zfp46	T	C	4: 136,291,009	S385P	probably damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	intron	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	intron	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GATGCCCTCAGTGGACATAG -3'
(R):5'- CTACAACAAATTCTTCTAGTGCACC -3'

Sequencing Primer
(F):5'- GGACATAGATAAACTGGACTTTCCCG -3'
(R):5'- CTTCTAGTGCACCAAAAATGATGAC -3'

Posted On

2018-03-15