Incidental Mutation 'R6286:Gdf2'
ID508248
Institutional Source Beutler Lab
Gene Symbol Gdf2
Ensembl Gene ENSMUSG00000072625
Gene Namegrowth differentiation factor 2
SynonymsBmp9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6286 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location33941039-33947198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33945100 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 260 (R260C)
Ref Sequence ENSEMBL: ENSMUSP00000098286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100720]
PDB Structure
Pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
non-latent pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000100720
AA Change: R260C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098286
Gene: ENSMUSG00000072625
AA Change: R260C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:TGFb_propeptide 55 256 8.5e-21 PFAM
TGFB 326 428 3.83e-56 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates cartilage and bone development, angiogenesis and differentiation of cholinergic central nervous system neurons. Homozygous null mice exhibit malformations of the vasculature and skeleton. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show arteriovenous malformations, skeletal anomalies, and abnormal retinal vasculature after anti-BMP10-antibody treatment. Homozygotes for a different null allele show abnormal retinal and tracheal vasculature and tracheal lymphatic vessels after anti-BMP10 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T A 17: 71,880,847 M1300L probably damaging Het
BC080695 T A 4: 143,571,226 V72D probably benign Het
C3 A T 17: 57,224,118 I356N probably damaging Het
Cntnap5b T A 1: 100,255,073 S276T possibly damaging Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp11a1 G A 9: 58,017,418 probably benign Het
Ddx4 T C 13: 112,613,735 T421A probably damaging Het
Dnttip2 A G 3: 122,284,400 T694A probably damaging Het
Eif3b G T 5: 140,419,811 D151Y probably damaging Het
Fhad1 T A 4: 141,920,898 E219V probably damaging Het
Gm14295 T C 2: 176,809,568 Y284H possibly damaging Het
Gm45861 A G 8: 27,529,591 T745A unknown Het
Grin2a G A 16: 9,761,775 T208I possibly damaging Het
Ide T A 19: 37,278,010 Y798F unknown Het
Llgl1 G A 11: 60,709,532 G569D probably damaging Het
Mrpl9 G C 3: 94,443,790 E92D probably benign Het
Muc16 T A 9: 18,644,389 H3536L unknown Het
Nasp T C 4: 116,604,788 Y526C probably damaging Het
Nfx1 A G 4: 40,986,728 N404D probably damaging Het
Nsrp1 A G 11: 77,049,443 I112T probably damaging Het
Olfr145 A T 9: 37,897,778 I125F probably damaging Het
Olfr789 T C 10: 129,487,628 L206P probably damaging Het
Oxsr1 A G 9: 119,264,882 V235A probably damaging Het
Pamr1 C T 2: 102,640,948 Q539* probably null Het
Ptpn4 A G 1: 119,721,862 probably null Het
Ranbp2 C T 10: 58,479,572 A2038V probably benign Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Sept5 A G 16: 18,623,377 V253A probably damaging Het
Slc22a13 C A 9: 119,208,712 E117* probably null Het
Slc9c1 T C 16: 45,577,831 I653T probably benign Het
Slco6c1 T A 1: 97,125,720 H152L possibly damaging Het
Sp2 A C 11: 96,961,546 V184G probably benign Het
Taok1 T A 11: 77,553,773 H492L probably benign Het
Tas2r110 G A 6: 132,868,527 D174N probably benign Het
Trim24 G A 6: 37,919,491 probably null Het
Ttc37 T C 13: 76,143,240 L993P probably damaging Het
Ttn G A 2: 76,750,977 R21445* probably null Het
Ttn A G 2: 76,775,623 Y16502H probably damaging Het
Vmn2r84 A C 10: 130,390,868 M367R possibly damaging Het
Zfp46 T C 4: 136,291,009 S385P probably damaging Het
Other mutations in Gdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0557:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0631:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0739:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R2142:Gdf2 UTSW 14 33945241 missense probably benign
R2292:Gdf2 UTSW 14 33945188 missense possibly damaging 0.60
R3615:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3616:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3974:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R3975:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R3976:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R4665:Gdf2 UTSW 14 33945451 missense probably damaging 1.00
R5007:Gdf2 UTSW 14 33944906 missense probably benign 0.02
R5227:Gdf2 UTSW 14 33941494 critical splice donor site probably null
R5253:Gdf2 UTSW 14 33945307 missense probably benign 0.14
R5259:Gdf2 UTSW 14 33944831 missense probably benign 0.01
R7644:Gdf2 UTSW 14 33944890 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTAGAAGTATCGAGTGCCGTG -3'
(R):5'- CCTCAAAGTTCACCCTGAGAG -3'

Sequencing Primer
(F):5'- TATCGAGTGCCGTGAAGCG -3'
(R):5'- AGTTCACCCTGAGAGAAGTCTTCTG -3'
Posted On2018-03-15