Incidental Mutation 'R6287:Ttl'
ID508261
Institutional Source Beutler Lab
Gene Symbol Ttl
Ensembl Gene ENSMUSG00000027394
Gene Nametubulin tyrosine ligase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6287 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location129065942-129096283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129089121 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 335 (A335T)
Ref Sequence ENSEMBL: ENSMUSP00000046883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035812]
Predicted Effect probably damaging
Transcript: ENSMUST00000035812
AA Change: A335T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046883
Gene: ENSMUSG00000027394
AA Change: A335T

DomainStartEndE-ValueType
Pfam:TTL 54 367 1.2e-72 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144120
AA Change: A193T
SMART Domains Protein: ENSMUSP00000117506
Gene: ENSMUSG00000027394
AA Change: A193T

DomainStartEndE-ValueType
Pfam:TTL 1 199 2.3e-64 PFAM
Meta Mutation Damage Score 0.4424 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TTL is a cytosolic enzyme involved in the posttranslational modification of alpha-tubulin (see MIM 602529). Alpha-tubulin within assembled microtubules is detyrosinated over time at the C terminus. After microtubule disassembly, TTL restores the tyrosine residues and consequently participates in a cycle of tubulin detyrosination and tyrosination (Erck et al., 2003 [PubMed 14571137]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, impaired breathing, and fail to form the internal capsule in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,311,108 N268S possibly damaging Het
Ahnak T A 19: 9,015,003 H4550Q probably benign Het
C330018D20Rik A C 18: 56,962,335 probably null Het
Camta2 G C 11: 70,681,469 Q310E probably damaging Het
Caskin1 A T 17: 24,496,709 K149M probably damaging Het
Chml T C 1: 175,687,003 K108E probably benign Het
Ddx60 T C 8: 61,950,578 L345P probably damaging Het
Defb6 T A 8: 19,228,069 C52* probably null Het
Flii A T 11: 60,721,597 I288N probably damaging Het
Fmnl2 T C 2: 53,014,848 Y55H probably damaging Het
Galk2 A T 2: 125,870,348 probably benign Het
Ift140 T A 17: 25,050,434 C688S probably benign Het
Lmln T C 16: 33,074,185 probably null Het
Muc16 T C 9: 18,659,034 T730A unknown Het
Nup88 T C 11: 70,965,755 E184G probably benign Het
Olfr1234 G A 2: 89,363,019 R137* probably null Het
Olfr13 A G 6: 43,174,435 I150V probably benign Het
Olfr1383 A G 11: 49,524,245 N174S probably damaging Het
Olfr1512 A T 14: 52,372,291 V254E probably damaging Het
Olfr810 T C 10: 129,791,385 E68G probably damaging Het
Omt2b T C 9: 78,328,261 F27L possibly damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pigf G A 17: 86,997,539 A192V probably damaging Het
Pikfyve T C 1: 65,253,532 probably null Het
Ppat A T 5: 76,918,214 Y352* probably null Het
Rapgef6 T G 11: 54,626,338 probably null Het
Rrp15 A T 1: 186,749,176 S45T probably benign Het
Sap18 A G 14: 57,798,314 E30G probably damaging Het
Snx6 G T 12: 54,747,028 A284E possibly damaging Het
Tm4sf4 T A 3: 57,425,691 I26N probably damaging Het
Traf5 A G 1: 191,999,872 L336P probably damaging Het
Vmn2r87 C T 10: 130,478,422 probably null Het
Zfp74 G A 7: 29,935,776 T169I probably benign Het
Zfp937 A T 2: 150,238,341 H97L possibly damaging Het
Zzef1 G T 11: 72,923,112 E2842D probably damaging Het
Other mutations in Ttl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02742:Ttl APN 2 129066293 missense possibly damaging 0.50
IGL02970:Ttl APN 2 129076070 missense probably damaging 1.00
R0363:Ttl UTSW 2 129076061 missense probably damaging 0.99
R2290:Ttl UTSW 2 129081270 missense possibly damaging 0.69
R3818:Ttl UTSW 2 129092994 missense probably damaging 1.00
R4345:Ttl UTSW 2 129075858 missense probably damaging 1.00
R4471:Ttl UTSW 2 129082057 missense probably benign
R4866:Ttl UTSW 2 129081227 missense probably damaging 1.00
R5269:Ttl UTSW 2 129068911 missense probably damaging 1.00
R5913:Ttl UTSW 2 129076041 missense probably benign
R5941:Ttl UTSW 2 129075984 missense probably benign 0.00
R6643:Ttl UTSW 2 129081342 missense possibly damaging 0.72
R6821:Ttl UTSW 2 129068915 missense probably damaging 1.00
R6883:Ttl UTSW 2 129082072 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCACACTTGGTATAGGATCTTCTG -3'
(R):5'- GAACCACAGGGAAATGGCTC -3'

Sequencing Primer
(F):5'- GATCTTCTGATCGGCATAGCC -3'
(R):5'- CAGGGAAATGGCTCAGCTAAGC -3'
Posted On2018-03-15