Incidental Mutation 'R6287:Snx6'
ID508281
Institutional Source Beutler Lab
Gene Symbol Snx6
Ensembl Gene ENSMUSG00000005656
Gene Namesorting nexin 6
Synonyms2810425K19Rik, 2010006G21Rik, 2610032J07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock #R6287 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location54746349-54795703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 54747028 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 284 (A284E)
Ref Sequence ENSEMBL: ENSMUSP00000151488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005798] [ENSMUST00000218934]
Predicted Effect probably benign
Transcript: ENSMUST00000005798
AA Change: A400E

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000005798
Gene: ENSMUSG00000005656
AA Change: A400E

DomainStartEndE-ValueType
Pfam:PX 29 170 2.8e-21 PFAM
Pfam:Vps5 184 399 2e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218934
AA Change: A284E

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associates with the long isoform of the leptin receptor, the transforming growth factor-beta family of receptor serine-threonine kinases, and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor. This protein may form oligomeric complexes with family member proteins through interactions of both the PX domain and the coiled coil regions of the molecules. Translocation of this protein from the cytoplasm to the nucleus occurs after binding to proviral integration site 1 protein. This gene results in two transcripts encoding two distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,311,108 N268S possibly damaging Het
Ahnak T A 19: 9,015,003 H4550Q probably benign Het
C330018D20Rik A C 18: 56,962,335 probably null Het
Camta2 G C 11: 70,681,469 Q310E probably damaging Het
Caskin1 A T 17: 24,496,709 K149M probably damaging Het
Chml T C 1: 175,687,003 K108E probably benign Het
Ddx60 T C 8: 61,950,578 L345P probably damaging Het
Defb6 T A 8: 19,228,069 C52* probably null Het
Flii A T 11: 60,721,597 I288N probably damaging Het
Fmnl2 T C 2: 53,014,848 Y55H probably damaging Het
Galk2 A T 2: 125,870,348 probably benign Het
Ift140 T A 17: 25,050,434 C688S probably benign Het
Lmln T C 16: 33,074,185 probably null Het
Muc16 T C 9: 18,659,034 T730A unknown Het
Nup88 T C 11: 70,965,755 E184G probably benign Het
Olfr1234 G A 2: 89,363,019 R137* probably null Het
Olfr13 A G 6: 43,174,435 I150V probably benign Het
Olfr1383 A G 11: 49,524,245 N174S probably damaging Het
Olfr1512 A T 14: 52,372,291 V254E probably damaging Het
Olfr810 T C 10: 129,791,385 E68G probably damaging Het
Omt2b T C 9: 78,328,261 F27L possibly damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pigf G A 17: 86,997,539 A192V probably damaging Het
Pikfyve T C 1: 65,253,532 probably null Het
Ppat A T 5: 76,918,214 Y352* probably null Het
Rapgef6 T G 11: 54,626,338 probably null Het
Rrp15 A T 1: 186,749,176 S45T probably benign Het
Sap18 A G 14: 57,798,314 E30G probably damaging Het
Tm4sf4 T A 3: 57,425,691 I26N probably damaging Het
Traf5 A G 1: 191,999,872 L336P probably damaging Het
Ttl G A 2: 129,089,121 A335T probably damaging Het
Vmn2r87 C T 10: 130,478,422 probably null Het
Zfp74 G A 7: 29,935,776 T169I probably benign Het
Zfp937 A T 2: 150,238,341 H97L possibly damaging Het
Zzef1 G T 11: 72,923,112 E2842D probably damaging Het
Other mutations in Snx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Snx6 APN 12 54754309 missense probably damaging 0.99
IGL02682:Snx6 APN 12 54754345 missense probably damaging 1.00
IGL02995:Snx6 APN 12 54795510 splice site probably benign
IGL03240:Snx6 APN 12 54783443 missense probably damaging 0.98
IGL03353:Snx6 APN 12 54765684 splice site probably benign
PIT4362001:Snx6 UTSW 12 54768030 missense possibly damaging 0.80
R0458:Snx6 UTSW 12 54768136 nonsense probably null
R0610:Snx6 UTSW 12 54751789 missense probably damaging 1.00
R0689:Snx6 UTSW 12 54763656 missense probably benign 0.00
R1818:Snx6 UTSW 12 54783474 missense possibly damaging 0.95
R1819:Snx6 UTSW 12 54783474 missense possibly damaging 0.95
R4946:Snx6 UTSW 12 54770743 missense probably damaging 1.00
R5275:Snx6 UTSW 12 54784022 missense probably damaging 1.00
R5373:Snx6 UTSW 12 54770728 missense probably damaging 0.99
R5374:Snx6 UTSW 12 54770728 missense probably damaging 0.99
R5497:Snx6 UTSW 12 54757061 missense probably damaging 0.98
R5907:Snx6 UTSW 12 54754319 missense probably damaging 1.00
R5947:Snx6 UTSW 12 54770764 nonsense probably null
R6178:Snx6 UTSW 12 54760464 missense probably damaging 0.99
R6321:Snx6 UTSW 12 54752013 missense probably damaging 1.00
R6878:Snx6 UTSW 12 54763601 intron probably null
R7055:Snx6 UTSW 12 54784079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCACTGTCTCTCAGAAG -3'
(R):5'- ATAGAGATGTTTCCAGAATTGTGAC -3'

Sequencing Primer
(F):5'- CACTGTCTCTCAGAAGAAGAGCTG -3'
(R):5'- TGTTTCCAGAATTGTGACATTAGAG -3'
Posted On2018-03-15