Incidental Mutation 'R6287:Olfr1512'
ID508282
Institutional Source Beutler Lab
Gene Symbol Olfr1512
Ensembl Gene ENSMUSG00000094140
Gene Nameolfactory receptor 1512
SynonymsGA_x6K02T2RJGY-622120-623061, MOR223-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6287 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52371332-52379168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52372291 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 254 (V254E)
Ref Sequence ENSEMBL: ENSMUSP00000149717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071221] [ENSMUST00000214980]
Predicted Effect probably damaging
Transcript: ENSMUST00000071221
AA Change: V254E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071208
Gene: ENSMUSG00000094140
AA Change: V254E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.1e-48 PFAM
Pfam:7tm_1 41 290 2.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200261
Predicted Effect probably damaging
Transcript: ENSMUST00000214980
AA Change: V254E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,311,108 N268S possibly damaging Het
Ahnak T A 19: 9,015,003 H4550Q probably benign Het
C330018D20Rik A C 18: 56,962,335 probably null Het
Camta2 G C 11: 70,681,469 Q310E probably damaging Het
Caskin1 A T 17: 24,496,709 K149M probably damaging Het
Chml T C 1: 175,687,003 K108E probably benign Het
Ddx60 T C 8: 61,950,578 L345P probably damaging Het
Defb6 T A 8: 19,228,069 C52* probably null Het
Flii A T 11: 60,721,597 I288N probably damaging Het
Fmnl2 T C 2: 53,014,848 Y55H probably damaging Het
Galk2 A T 2: 125,870,348 probably benign Het
Ift140 T A 17: 25,050,434 C688S probably benign Het
Lmln T C 16: 33,074,185 probably null Het
Muc16 T C 9: 18,659,034 T730A unknown Het
Nup88 T C 11: 70,965,755 E184G probably benign Het
Olfr1234 G A 2: 89,363,019 R137* probably null Het
Olfr13 A G 6: 43,174,435 I150V probably benign Het
Olfr1383 A G 11: 49,524,245 N174S probably damaging Het
Olfr810 T C 10: 129,791,385 E68G probably damaging Het
Omt2b T C 9: 78,328,261 F27L possibly damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pigf G A 17: 86,997,539 A192V probably damaging Het
Pikfyve T C 1: 65,253,532 probably null Het
Ppat A T 5: 76,918,214 Y352* probably null Het
Rapgef6 T G 11: 54,626,338 probably null Het
Rrp15 A T 1: 186,749,176 S45T probably benign Het
Sap18 A G 14: 57,798,314 E30G probably damaging Het
Snx6 G T 12: 54,747,028 A284E possibly damaging Het
Tm4sf4 T A 3: 57,425,691 I26N probably damaging Het
Traf5 A G 1: 191,999,872 L336P probably damaging Het
Ttl G A 2: 129,089,121 A335T probably damaging Het
Vmn2r87 C T 10: 130,478,422 probably null Het
Zfp74 G A 7: 29,935,776 T169I probably benign Het
Zfp937 A T 2: 150,238,341 H97L possibly damaging Het
Zzef1 G T 11: 72,923,112 E2842D probably damaging Het
Other mutations in Olfr1512
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr1512 APN 14 52372510 missense probably damaging 1.00
IGL01375:Olfr1512 APN 14 52372408 missense probably damaging 0.99
IGL02343:Olfr1512 APN 14 52372477 missense probably damaging 1.00
R1443:Olfr1512 UTSW 14 52372951 missense probably damaging 1.00
R1902:Olfr1512 UTSW 14 52372717 missense possibly damaging 0.81
R1903:Olfr1512 UTSW 14 52372717 missense possibly damaging 0.81
R3115:Olfr1512 UTSW 14 52372940 missense probably damaging 1.00
R4752:Olfr1512 UTSW 14 52372307 missense probably damaging 1.00
R5345:Olfr1512 UTSW 14 52372268 nonsense probably null
R5689:Olfr1512 UTSW 14 52372757 missense possibly damaging 0.83
R6185:Olfr1512 UTSW 14 52372562 missense possibly damaging 0.91
R6757:Olfr1512 UTSW 14 52372715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCTGGGTGTCTCCTCAG -3'
(R):5'- TACCACAGTCAATGAGTTGGTG -3'

Sequencing Primer
(F):5'- GAGGTGCTCAGACCTCACTCTTAG -3'
(R):5'- CACAGTCAATGAGTTGGTGACCTTTG -3'
Posted On2018-03-15