Mutagenetix > Incidental Mutation

Incidental Mutation 'R6287:Ift140'

508286

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6287 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25050434 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 688 (C688S)

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

AlphaFold

E9PY46

Predicted Effect

probably benign
Transcript: ENSMUST00000024983
AA Change: C688S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: C688S

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137386
AA Change: C688S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: C688S

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140692

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153895

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

94% (34/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	A	G	8: 88,311,108	N268S	possibly damaging	Het
Ahnak	T	A	19: 9,015,003	H4550Q	probably benign	Het
C330018D20Rik	A	C	18: 56,962,335		probably null	Het
Camta2	G	C	11: 70,681,469	Q310E	probably damaging	Het
Caskin1	A	T	17: 24,496,709	K149M	probably damaging	Het
Chml	T	C	1: 175,687,003	K108E	probably benign	Het
Ddx60	T	C	8: 61,950,578	L345P	probably damaging	Het
Defb6	T	A	8: 19,228,069	C52*	probably null	Het
Flii	A	T	11: 60,721,597	I288N	probably damaging	Het
Fmnl2	T	C	2: 53,014,848	Y55H	probably damaging	Het
Galk2	A	T	2: 125,870,348		probably benign	Het
Lmln	T	C	16: 33,074,185		probably null	Het
Muc16	T	C	9: 18,659,034	T730A	unknown	Het
Nup88	T	C	11: 70,965,755	E184G	probably benign	Het
Olfr1234	G	A	2: 89,363,019	R137*	probably null	Het
Olfr13	A	G	6: 43,174,435	I150V	probably benign	Het
Olfr1383	A	G	11: 49,524,245	N174S	probably damaging	Het
Olfr1512	A	T	14: 52,372,291	V254E	probably damaging	Het
Olfr810	T	C	10: 129,791,385	E68G	probably damaging	Het
Omt2b	T	C	9: 78,328,261	F27L	possibly damaging	Het
Peg10	T	TCCC	6: 4,756,451		probably benign	Het
Pigf	G	A	17: 86,997,539	A192V	probably damaging	Het
Pikfyve	T	C	1: 65,253,532		probably null	Het
Ppat	A	T	5: 76,918,214	Y352*	probably null	Het
Rapgef6	T	G	11: 54,626,338		probably null	Het
Rrp15	A	T	1: 186,749,176	S45T	probably benign	Het
Sap18	A	G	14: 57,798,314	E30G	probably damaging	Het
Snx6	G	T	12: 54,747,028	A284E	possibly damaging	Het
Tm4sf4	T	A	3: 57,425,691	I26N	probably damaging	Het
Traf5	A	G	1: 191,999,872	L336P	probably damaging	Het
Ttl	G	A	2: 129,089,121	A335T	probably damaging	Het
Vmn2r87	C	T	10: 130,478,422		probably null	Het
Zfp74	G	A	7: 29,935,776	T169I	probably benign	Het
Zfp937	A	T	2: 150,238,341	H97L	possibly damaging	Het
Zzef1	G	T	11: 72,923,112	E2842D	probably damaging	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25035835	missense	probably benign
R8932:Ift140	UTSW	17	25086888	missense	probably benign	0.03
R9226:Ift140	UTSW	17	25098865	missense	probably benign	0.00
R9347:Ift140	UTSW	17	25094779	missense	probably benign	0.00
R9451:Ift140	UTSW	17	25033951	missense	probably benign	0.33
R9456:Ift140	UTSW	17	25035784	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TACTGCTGGCGTTGACTGAC -3'
(R):5'- TGCAAGGCAAGGGTTTATGG -3'

Sequencing Primer
(F):5'- TTGACTGACAGCAGCGG -3'
(R):5'- TATGGAAATGACCTTGGTGGCAC -3'

Posted On

2018-03-15