Incidental Mutation 'R6289:Trpc4ap'
ID508291
Institutional Source Beutler Lab
Gene Symbol Trpc4ap
Ensembl Gene ENSMUSG00000038324
Gene Nametransient receptor potential cation channel, subfamily C, member 4 associated protein
SynonymsD2Ertd113e, Trrp4ap, 4833429F06Rik, Trp4-associated protein TAP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R6289 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location155634271-155692384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155663707 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 203 (T203A)
Ref Sequence ENSEMBL: ENSMUSP00000099429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041059] [ENSMUST00000103140]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041059
AA Change: T203A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037574
Gene: ENSMUSG00000038324
AA Change: T203A

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 407 714 5.2e-135 PFAM
low complexity region 724 735 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103140
AA Change: T203A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099429
Gene: ENSMUSG00000038324
AA Change: T203A

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 399 710 1.1e-138 PFAM
low complexity region 716 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152548
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Trpc4ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Trpc4ap APN 2 155639535 missense possibly damaging 0.90
IGL02149:Trpc4ap APN 2 155639547 missense probably damaging 0.97
IGL02313:Trpc4ap APN 2 155650468 missense probably damaging 1.00
IGL02408:Trpc4ap APN 2 155671069 missense possibly damaging 0.71
R0057:Trpc4ap UTSW 2 155640486 missense possibly damaging 0.94
R0057:Trpc4ap UTSW 2 155640486 missense possibly damaging 0.94
R0255:Trpc4ap UTSW 2 155657946 splice site probably benign
R0306:Trpc4ap UTSW 2 155636260 missense probably benign 0.37
R0382:Trpc4ap UTSW 2 155636230 missense probably damaging 1.00
R0525:Trpc4ap UTSW 2 155640478 missense possibly damaging 0.85
R1184:Trpc4ap UTSW 2 155645070 splice site probably benign
R1711:Trpc4ap UTSW 2 155657744 missense probably benign 0.01
R2113:Trpc4ap UTSW 2 155657936 missense probably damaging 0.99
R3810:Trpc4ap UTSW 2 155643435 missense probably damaging 1.00
R4384:Trpc4ap UTSW 2 155640507 missense possibly damaging 0.85
R4664:Trpc4ap UTSW 2 155672997 missense probably benign 0.04
R4690:Trpc4ap UTSW 2 155635133 missense probably damaging 0.97
R5347:Trpc4ap UTSW 2 155672988 critical splice donor site probably null
R5655:Trpc4ap UTSW 2 155653627 missense possibly damaging 0.95
R5689:Trpc4ap UTSW 2 155671035 splice site probably null
R5828:Trpc4ap UTSW 2 155635210 intron probably benign
R5894:Trpc4ap UTSW 2 155666213 missense probably benign 0.11
R6056:Trpc4ap UTSW 2 155671074 missense probably damaging 1.00
R6539:Trpc4ap UTSW 2 155636258 missense probably benign 0.00
R6682:Trpc4ap UTSW 2 155637767 critical splice acceptor site probably null
R7022:Trpc4ap UTSW 2 155657822 missense probably benign 0.01
R7031:Trpc4ap UTSW 2 155692215 missense unknown
X0018:Trpc4ap UTSW 2 155653564 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGTTCACAGCCATGGATG -3'
(R):5'- TCATGCTAGTTTTCCAAGATGGG -3'

Sequencing Primer
(F):5'- CATGGATGGAACCCAGCG -3'
(R):5'- CCAAGATGGGGTTATTTTCTGCATC -3'
Posted On2018-03-15